Epigenetica Theorie en mogelijke implicaties Dr. Marco Boks Dr. Bart Rutten
Disclosure Bart Rutten • Speaker fees received from: Lundbeck
• Positions held on Advisory Boards: No
• Grants and sponsoring: No
Disclosure Marco Boks • Speaker fees received from: - Astra Zenica - Lundbeck
• Positions held on Advisory Boards: - Geen
• Grants and sponsoring: - Geen
Stellingen • 1. Alleen de DNA sequentie (i.e. genetische factoren) is overerfbaar • 2. Het epigenetisch profiel van een individu is stabiel over de tijd • 3. Epigenetische mechanismen medieren de persistentie van de invloeden van omgevingsinvloeden op phenotypes
Development of the number of citations including the term epigenetic.
Gräff J et al. Physiol Rev 2011;91:603-649
©2011 by American Physiological Society
From epidemiology to neuroscience
Hersenen
Van Os, Kenis, Rutten. Nature. 2010
EPIGENETICS X
Genotype unchanged Phenotype unchanged
X
X
DNA mutation
no DNA mutation
Genotype changed Phenotype changed
Genotype unchanged Phenotype changed
Epigenetic Mechanisms • • •
DNA methylation histone tail alterations microRNA, etc…
2 meters DNA per cell millions of neurons
Epigenetics & the environment = changes in phenotype and/or gene expression by mechanisms other than changes in the DNA sequence itself
ENVIRONMENT`
DNA Methylation ↓Gene Transcription MTHFR, DNMT1, DNMT3a, DNMT3b methyl gene promoter
exon 1
exon 2
I. blocks transcription factors
II. attracts gene repressing molecules
quantity * e.g. MeCP2, mutations in MeCP2 -> Rett syndrome
Pishva et al. Translational Neuroscience. 2012
Agouti ACATATACGCGCGCGCGCGCGCGATATATCTGTCAA
Agouti-gen
promoter
exon 1
exon 2
Jirtle et al. NRG 2007
Identical genotype
Agouti
X X
= methyl pregnancy
Jirtle et al. NRG 2007
Postnatal environment methyl administration Low maternal care High maternal care glucocorticoid receptor gene methyl
promoter exon 1
exon 2 RNA of glucocorticoid receptor in hippocampus
Epigenetics and childhood trauma in human brain
Glucocorticoid receptor methylation
Glucocorticoid receptor mRNA expression
McGowan et al. Nature Neuroscience 2009
DNA methylation in psychosis
Histone Tail Alterations
Tsankova et al. NRN 2007
Social Stress bdnf
gene bdnf
bdnf
Hippocampus protein
no stress
BDNF bdnf bdnf
bdnf
chronic stress BDNF
bdnf
bdnf
bdnf
chronic stress chronic TCA BDNF
Tsankova et al. NRN 2007
Genes regulating chromatin & bipolar disorder? Genetic variations in genes involved in H3K4 methylation show associations with bipolar disorder
Transgenerational Epigenetics pregnant female
Altered DNA methylation Several generations: Identical genetic sequence Identical environment Altered DNA methylation Altered phenotype
F4
Anyway et al. Science 2005 Jirtle et al. NRG 2007
History repeating?
Jean-Baptiste Lamarck 1744 -1829 Theory: Heritability of acquired traits Lamarckism 1920s, William McDougall: training rats in a maze Offspring of trained rats >> offspring of non-trained rats
Environment DNA
SNP/mutation
gene promoter
exon 1
exon 2
EPIGENETIC RNA
Inheritable Protein
quantity Cell functions
quality
Working model Subclinical experiences
Paternal age
Maternal infection
Childhood trauma
Perinatal events
Maternal stress
Nutrition
Rearing environment
Hypoxia
Prodromal state
Disorder
Cannabis
Urban environment
Stress
Migration
Rutten & Mill. Schiz Bull. 2009
Epigenetica: theorie en mogelijke implicaties Deel II Marco Boks Bart Rutten
Stelling Epigenetische veranderingen zijn zeldzaam
• Relatie met psychiatrische aandoeningen • Relatie met medicatie • Omgevingsinvloed • Quiz
Wat is interessant aan epigenetica? • • • • •
Erfelijk Omgeving Trans generationele leer effecten Belangrijk in ontwikkeling Beïnvloedbaar door medicatie en dieet
Uitdagingen • • • •
Invloed leeftijd en geslacht Invloed van DNA sequence variatie Invloed van medicatie Weefsel type
Correlatie tussen bloed en brein voor methylation levels onder invloed van leeftijd
Horvath et al. Genome Biology 2012 13:R97
Sample plot of methylation levels by genotype groups
Boks MP et al. The relationship of DNA methylation with age, gender and genotype in twins and healthy controls. PLoS One. 2009.
Cis and Trans correlations between DNA methylation and gene expression
van Eijk KR, de Jong S, Boks MP, et alBMC Genomics. 2012 Nov 17;13(1):636.
Stelling “Epigenetische” medicijnen zijn volop in ontwikkeling
MPM Boks et al, Epigenetics, 2012
Boks MP, de Jong NM, Kas MJ, Vinkers CH, Fernandes C, Kahn RS, Mill J, Ophoff RA. Current status and future prospects for epigenetic psychopharmacology. Epigenetics. 2012 Jan 1;7(1)
Stelling De belangrijkste invloed op epigenetica is voor de geboorte
Omgevingsinvloed • • • • • • •
Prenatal nutrition Prenatal exposure to alcohol Other drugs of abuse Prenatal stress Maternal care Traumatic early life experiences Environmental enrichment
Kofink, Boks, Kas, Neuroscience and Biobehavioral Reviews, in press
Psychiatrische aandoeningen • • • • • • •
Depressie Autisme Schizofrenie Bipolaire stoornis Cocaïne afhankelijkheid Alcoholisme Alzheimer
Bunnik Angry Bird Epigenetics Award • 12 stellingen • Rechterhand omhoog is JUIST • Bij fout antwoord gaan zitten
Vragen • Er zijn meer dan 25 epigenetische mechanismen • Honger voor de geboorte heeft effect op de epigenetische status van het kind • Met de leeftijd neemt DNA methylatie af (alles wordt minder). • Er zijn geen medicijnen die direct op DNA methylatie werken
• Natriumvalproaat is een HDAC inhibitor • DNA methylatie verlaagd de expressie van genen
Vragen?
Universiteit Maastricht Bart Rutten
[email protected] UMC Utrecht Marco Boks
[email protected]
[email protected]
