MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA DISERTAČNÍ PRÁCE

MENDELOVA UNIVERZITA V BRNĚ AGRONOMICKÁ FAKULTA

DISERTAČNÍ PRÁCE

BRNO 2012

DALIBOR HÚSKA

Mendelova univerzita v Brně Agronomická fakulta Ústav chemie a biochemie

Markery pro posouzení hyperakumulace, senzitivity a rezistence rostlin k těţkým kovům Disertační práce

Vedoucí práce: Prof. Ing. René Kizek, Ph.D.

Vypracoval: Ing. Dalibor Húska

Brno 2012

PROHLÁŠENÍ Prohlašuji, ţe jsem disertační práci na téma Markery pro posouzení hyperakumulace, senzitivity a rezistence rostlin k těţkým kovům vypracoval samostatně a pouţil jen pramenů, které cituji a uvádím v přiloţeném seznamu literatury. Disertační práce je školním dílem a můţe být pouţita ke komerčním účelům jen se souhlasem vedoucího disertační práce a děkana Agronomické fakulty Mendelovy univerzity v Brně. dne 31. 8. 2012 Dalibor Húska……………………….

Zpracovaná disertační práce byla finančně podpořena z prostředků specifického vysokoškolského výzkumu prostřednictvím projektu IGA AF č. TP7/2011.

Tato práce vznikla v rámci projektu CEITEC - Středoevropského technologického institutu s pomocí výzkumné infrastruktury financované projektem CZ.1.05/1.1.00/02.0068 z Evropského fondu regionálního rozvoje.

Počátek a konec se stávají blízkými sousedy. V notové osnově můžeme začít s nejnižším tónem a dospět k nejvyššímu. Když jej dosáhneme, zjistíme, že je hned vedle nejnižšího…Cíl zde není vždy, aby byl dosažen. Mnohdy je zde proto, aby bylo kam směřovat… Bruce Lee

PODĚKOVÁNÍ

První poděkování patří Renému Kizekovi za vzdělání, které mi poskytl nad rámec běžné výuky a za jeho trpělivé vedení a za mnoho hodin konzultací strávených nad prací. Poděkovat touto formou chci i panu prof. RNDr. Ladislavu Havlovi, CSc. za poskytnuté konzultace, rady a odborné vedení během studia. Poděkování náleží i kolegům z laboratoře, za vytváření báječných pracovních podmínek a úsměvných dnů, dnes už historek.

Speciálně chci poděkovat Vojtěchu Adamovi za neustálé otáčení se na židli směr k mému stolu a za vždy trpělivé odpovídání na mé dotazy.

Poděkování patří i všem spoluautorům, bez kterých by publikace, tvořící základ této práce, nevznikly.

Děkuji i své rodině za podporu a vytváření co nejlepších podmínek během celého studia.

Velké děkuji, patří mé ženě a synkovi, kteří mi dodávají tolik potřebnou energii, duševní podporu a vytváří zázemí krásného domova.

ABSTRAKT Předkládaná práce je zaměřena na hledání vhodných nástrojů a metod (fyzikálních i biologických) pro sledování odpovědi rostlin na ionty těţkých kovů. V této práci jsme propojili elektrochemické metody s paramagnetickými částicemi a nanočásticemi pro studium nukleových kyselin a proteinů hrající roli v biologických procesech rostlin, ovlivněných těţkými kovy. Nejdříve byla optimalizována detekce a izolace nukleových kyselin pomocí elektrochemických technik, paramagnetických částic, nanočástic a nanoelektrod zapojených v automatickém systému. Navíc byla navrţena metoda izolace a detekce specifických nukleových kyselin zaloţená na hybridizačním kitu. Další část práce se zabývala vyuţitím navrhnutých a optimalizovaných metod na reálných vzorcích. Studován byl efekt iontů kadmia na raná somatická embrya smrku ztepilého (ESEs). Paramagnetické částice byly vyuţity pro izolaci celkové mRNA u vzorků ESEs a kukuřice seté, které byly ovlivněny ionty kadmia. Jednoduchá, rychlá a efektivní izolace a detekce nukleových kyselin z biologického materiálu je základem pro studium genové exprese a vyuţití čipových technologií. Studium vlivu těţkých kovů na rostliny a hledání nových analytických metod a postupů, nám umoţňuje posuzovat výběr a vhodnost rostlin pro fytoremediační techniky.

Klíčová slova: rostlinný stres, těţké kovy, fytoremediace, markéry, DNA, mRNA, thioly, elektrochemie, nanotechnologie, paramagnetické částice

8

ABSTRACT The thesis is focused on searching of fit instrument and methods (physical and biological) for monitoring interaction of plants to heavy metals ions. In this work we interfaced an electrochemical method with paramagnetic particles and nanoparticles for studying nucleic acids and proteins, which play role in plants biological processes induced by heavy metals. First of all we optimized isolation and detection of nucleic acid by using electrochemistry, paramagnetic particles, nanoparticles and nanoelectrode in automatic system. Further we suggest isolation and detection of specific nucleic acid based on hybridization kit. Next part of work we used the suggested and optimised methods for analysis of real samples. We studied the effect of cadmium(II) ions on early somatic embryos (ESEs) of Norway spruce. We also utilize paramagnetic particles for isolation of total mRNA from ESEs and maize plants (Zea mays L.) treated with cadmium(II) ions. Easy, efficient and low demanding separation of nucleic acids from biological material is needed to study gene expression and to use in chip technologies. Study of impact of heavy metals on plants and searching a new analytical methods and procedures is very important for understanding of appraisal to right choose of plants for phytoremendiation.

Keywords: plant stress, heavy metals, phytoremediation, DNA, mRNA, thiols, electrochemistry, nanotechnology, paramagnetic particles

9

OBSAH

1

ÚVOD ................................................................................................................................. 13

2

CÍLE PRÁCE ...................................................................................................................... 14

3

LITERÁRNÍ PŘEHLED ..................................................................................................... 15 3.1

Těţké kovy a ţivotní prostředí .................................................................................... 15

3.2

Těţké kovy a rostliny .................................................................................................. 16

3.2.1

Definice těţkých kovů u rostliny ........................................................................ 16

3.2.2

Odpověď rostliny na abiotický stres ................................................................... 16

3.2.3

Průběh stresové reakce u rostlin .......................................................................... 17

3.2.4

Stres a exprese proteinů ...................................................................................... 19

3.2.5

Signální dráhy a jejich role při stresových podmínkách ..................................... 20

3.2.6

MikroRNA .......................................................................................................... 25

Příjem a transport kovů rostlinou ................................................................................ 28

3.3

Příjem kademnatých iontů................................................................................... 30

3.3.1

Vliv těţkých kovů na rostliny ..................................................................................... 32

3.4 3.4.1

Genová exprese a kademnaté ionty ..................................................................... 33

3.4.2

Transkripční faktory ............................................................................................ 34

3.4.2.1

ERF transkripční faktory ................................................................................. 35

3.4.2.2

bZIP transkripční faktory ................................................................................ 35

3.4.2.3

WRKY transkripční faktory ............................................................................ 36

3.5

Fytoremediace ............................................................................................................. 36

3.5.1

Hyperakumulátory............................................................................................... 37

3.5.2

Mechanismus účinku ........................................................................................... 38

3.5.3

Glutation a fytochelatiny ..................................................................................... 40

3.5.3.1

Geny zapojené do syntézy glutationu.............................................................. 42

3.5.3.2

Geny zapojené do transportu glutationu.......................................................... 43

3.5.3.3

Geny zapojené do degradace glutationu.......................................................... 43

3.5.3.4

Detoxifikace těţkých kovů fytochelatiny ........................................................ 44

3.5.4 3.6

Reaktivní formy kyslíku ...................................................................................... 46 Metody pro posouzení míry stresu u rostlin ................................................................ 51

3.6.1

Transkriptomika a genomika ............................................................................... 51

3.6.2

Paramagnetické částice ....................................................................................... 53

3.6.2.1

Nanotechnologie ............................................................................................. 54

10

3.6.3

4

Elektrochemické bionanosenzory ....................................................................... 56

3.6.3.1

Nanočástice a Elektrochemické bionanosenzory ............................................ 56

3.6.3.2

Kvantové tečky................................................................................................ 59

MATERIÁL A METODIKA .............................................................................................. 62 Materiál a chemikálie .................................................................................................. 62

4.2

5

4.2.1

Nanočástice ......................................................................................................... 62

4.2.2

Příprava ODN-SH- NPs ...................................................................................... 63

4.3

Automatická izolace technikou epMotions ................................................................. 63

4.4

Elektrochemická detekce na rtuťové elektrodě ........................................................... 63

4.5

Rostlinný materiál ....................................................................................................... 64

4.6

Polymerázová řetězová reakce .................................................................................... 65

4.7

Mikroskopická analýza RSE ....................................................................................... 65

VÝSLEDKY A DISKUSE ................................................................................................. 66 5.2

Význam tiolových látek v rostlinách a jejich elektrochemická analýza ..................... 68 Vědecký článek I ................................................................................................. 68

5.2.1

5.2.2 Literární rešerše o významu tiolových látek v rostlinách a jejich stanovení pomocí elektrochemických technik. .................................................................................... 97 5.3

Studium vlivu kademnatých iontů na raná somatická embrya smrku ztepilého ......... 98 Vědecký článek II ............................................................................................... 98

5.3.1

5.3.2 Analýza vliv iontů kadmia na raná somatická embrya Smrku ztepilého pomocí elektrochemických technik a nukleární magnetické rezonance. ....................................... 114 Detekce a izolace nukleových kyselin ...................................................................... 117

5.4 5.4.1

Vědecký článek III ............................................................................................ 117

5.4.2 Detekce nukleových kyselin amplifikovaných pomocí PCR za vyuţití miniaturizovaného elektrochemického detektoru. ............................................................ 126 5.4.3

Vědecký článek IV ............................................................................................ 128

5.4.4 Mikro a nano-trubicemi modifikované pevné elektrody pro detekci nukleových kyselin…. .......................................................................................................................... 134 5.4.5

Vědecký článek V ............................................................................................. 136

5.4.6 Automatická izolace nukleových kyselin pomocí paramagnetických částic s elektrochemickou detekcí ............................................................................................... 147 5.5 Studium rostlinného transkriptomu pomocí paramagnetických částic a elektrochemických metod ..................................................................................................... 148 5.5.1

Vědecký článek VI ............................................................................................ 148

Microfluidic robotic device coupled with electrochemical sensor field for handling of paramagnetic micro-particles as a tool for determination of plant mRNA. ...................... 148

11

5.5.2 Elektrochemická analýza rostlinné mRNA izolované pomocí paramagnetických mikro-částic v automatickém systému. ............................................................................. 158 5.6 Markery pro posouzení hyperakumulace, senzitivity a rezistence rostlin k těţkým kovům ………………………………………………………………………………….......160 Vědecký článek v přípravě ................................................................................................ 160 6

Závěr ................................................................................................................................. 168

7

POUŢITÁ LITERATURA................................................................................................ 169

12

1

ÚVOD Věda rozvíjela lidstvo od jeho počátku, ačkoliv se na to tak nenahlíželo. Za

veškerým pokrokem stojí hlavně čtyři lidské vlastnosti – zvědavost, soucit, touha po moci a lenost. Přičemž u mnohých objevů se tyto vlastnosti vzájemně prolínají. Velcí objevitelé, zvědavi, co na ně v dáli oceánských vod čeká, se snažili vymyslet a sestrojit co nejvíce propracované lodě schopné, je do těch dálek přepravit. Po mnohých pokusech zjistili, že na širém oceánu se lze jen těžko orientovat bez dobré znalosti hvězd a kompasu. Velcí biologové hledali se soucitem příčiny nemocí zabíjející tisíce lidí a s urputnou snahou hledali lék, aby alespoň pár přeživších zachránili. Velcí dobyvatelé vymýšleli zařízení, která by měla co nejničivější efekt a dokázala porazit a podmanit si „ty druhé“ a získat tak moc nad půdou a lidí samotných. Lze zcela abstraktně říct, že díky tomu máme jadernou energii, mnohými tak zavrhovanou a jinými vyzdvihovanou. Lidé začínající s jakoukoliv činností, záhy přemýšlejí, jak onu činnost udělat rychleji, efektivněji a bez větší námahy. Dopravní prostředky, televize, počítač, mobil, kolo, traktor, kombajn, automat na kávu, výtah. To je jen velmi nepatrný výčet věcí, které každý den kolem sebe potkáváme či používáme, přičemž si zdánlivě myslíme, jak nám pomáhají vytvářet čas na „lenivění“. Velká většina populace dnes vědci a jejich prací opovrhují a však si neuvědomují, že celý svět a dnes více než kdykoliv jindy, funguje na výdobytcích vědy. Proti řečnickou otázkou stále zůstává, jestli tyto výdobytky nebudou nakonec stát na začátku konce planety Země. Předkládaná práce tvořená s velkou zvědavostí a touhou po efektivnosti, rychlosti a automatičnosti, nabízí náhled do biologických dějů, umožňující chránit rostliny před stresovými vlivy způsobenými těžkými kovy, nabízí náhled do metod, kterými lze tyto děje analyzovat a v neposlední řadě nabízí náhled na zcela nová či vylepšená technologická zařízení, umožňující prozkoumávat nám zatím neznámé daleké vody.

13

2

CÍLE PRÁCE Předkládaná práce je zaměřena na hledání vhodných nástrojů a metod (fyzikálních i

biologických) pro sledování odpovědi rostlin na ionty těţkých kovů. Nalezení vhodných technik a markérů hyperakumulace, senzitivity případně rezistence rostlin k těţkým kovům by umoţnilo zjednodušení procesu vyhledávání rostlin vyuţitelných ve fytoremediačních technologiích. Pro práci byly vybrány následující dílčí cíle: 

Připravit literární rešerši o vlivu iontů těţkých kovů na rostliny a popsat principy fytoremediačních techniky.



Navrhnout nové metody a postupy pro posouzení míry stresu těţkých kovů na rostliny



Optimalizovat

izolaci

nukleových

kyselin

DNA

a

mRNA

pomocí

paramagnetických částic 

Testovat elektrody modifikované nanotrubicemi jako nový materiál pro detekci nukleových kyselin



Studovat pomocí navrţených metod vliv kademnatých iontů na raná somatická embrya smrku ztepilého a rostliny kukuřice seté



Pomocí navrţených metod sledovat expresi na úrovni transkriptomu u rostlin ovlivněných kademnatými ionty.

14

3

LITERÁRNÍ PŘEHLED

3.1 Těžké kovy a životní prostředí Technologický pokrok lidstva se od jeho prapočátku setkává i s negativními následky. V každém období naší civilizace, bylo zapotřebí hledat techniky, které by umožnily vyvážit negativní dopad technologického pokroku a umožnily tak dál vytvářet a objevovat nové věci (Babula, a kol., 2008, Maksymiec, 2007). Každý z nás používá tři základní a nepostradatelné zdroje půdu, vodu a vzduch, bez kterých, by jen těžko dokázal přežít. Tyto zdroje nám poskytují vodu, potravu a nerostné suroviny. Všechny složky obsahují pro všechny živé organizmy nebezpečné látky, které se v nich vyskytují především přirozeně s tím, že lidská činnost na jejich nárůstu přispívá. Jedny z nejvíce nebezpečných látek jsou i těžké kovy (An, a kol., 2011, Dragovic, a kol., 2008, Rai, 2008, Yadav, 2010). Znečištění půdy, vody a ovzduší těmito látkami je stále rostoucím problémem na celém světě (Dragovic, a kol., 2008, Rascio a Navari-Izzo, 2011, Seo, a kol., 2006). Velkou měrou k tomu přispívá lidská činnost na jedné straně a je nutno si uvědomit, že mnohem větší měrou k tomu přispívají přirozené procesy jako geochemické zvětrávání hornin, sopečné výbuchy či kyselé deště, na straně druhé (An, a kol., 2011, Guo, a kol., 2009, Perales-Vela, a kol., 2006). Těžké kovy jako polutanty, můžeme rozdělit do tří skupin: i) toxické kovy (Hg, Cr, Pb, Cd, As, Co, Sn); ii) vzácné kovy (Pd, Pt, Ag, Au, Ru); iii) radionuklidy (U, Th, Ra, Am) (Ahsan, a kol., 2009, Appenroth, 2010). Nejvíce ovlivněnými organismy jsou pak rostliny i z toho důvodu, že nejsou schopny měnit svá stanoviště na rozdíl od zvířat, která mohou nevyhovující lokalitu opustit (di Toppi a Gabbrielli, 1999). Nejpočetnější skupinou rostlin vystavených působením těžkých kovů (Cd, Cu, Zn, Ni, Co, Cr, Pb) jsou pak zemědělské plodiny, které se často pěstují na půdách s vysokými koncentracemi těžkých kovů (An, a kol., 2011, Canovas, a kol., 2004, Mittler, 2006, Pal, a kol., 2006, Vamerali, a kol., 2010). Celosvětově se vyprodukuje několik desítek tun potencionálně nebezpečných plodin (An, a kol., 2011).

15

3.2 Těţké kovy a rostliny 3.2.1 Definice těţkých kovů u rostliny Termín ''těţký kov'' je nejčastěji definován především na základě hustoty, která říká, ţe všechny těţké kovy mají hustotu větší jak 5 g.cm-3 (Appenroth, 2010). Na základě této veličiny je pak o těţkých kovech, často milně, mluveno jako o toxických látkách (Abou Auda a Ali, 2010, Appenroth, 2010, Solanki a Dhankhar, 2011). Beryllium (Be) coţ je toxický kov, ale ne těţký kov. Ţelezo (Fe) a mangan (Mn), tedy těţké, ale ne toxické kovy. (Appenroth, 2010) navrhuje definovat těţké a toxické kovy několika, ale jednoznačnými termíny vycházející z periodické tabulky prvků. Navrhuje rozdělit skupinu těţkých kovů (pro pouţití v rostlinných vědách) do tří podskupin. První podskupinou jsou všechny tranzitivní (přechodné) prvky vyjma lanthanu (La) a aktinia (Ac). Druhou podskupinu by tvořily kovy vzácných zemin zahrnující lanthanoidy a aktinoidy včetně (La) a (Ac). Třetí podskupina (značně heterogenní) by byla zastoupena p-prvky včetně bismutu (Bi), amfoterními oxidy, kam patří (PbO, SnO, ZnO) a metaloidy – gerilium (Ge), astat (As) a telur (Te) (Appenroth, 2010). 3.2.2 Odpověď rostliny na abiotický stres Rostliny bývají neustále vystavovány kolísání podmínek prostředí, coţ má za následek omezení jejich růstu a vývoje v průběhu ţivotního cyklu (Kosova, a kol., 2011). Aklimatizace rostlin na měnící se podmínky vyţaduje řadu biochemických, fyziologických a molekulární změn. Rostliny mají dvě hlavní strategie jak reagovat na stres: i) vyhnutím se účinkům stresových faktorů ve fyziologicky neaktivní fázi a to ve formě semen nebo ii) stresové podmínky tolerovat respektive aktivně a reverzibilně se ke stresovým podmínkám přizpůsobovat tj. aklimatizovat. Rostliny se na stres aklimatizují hlavně prostřednictvím změn v expresi genů, které vedou ke změnám ve sloţení transkriptomu a následně proteomu. Avšak je nutno podotknout, ţe změny na úrovni transkriptomu nutně neznamenají odpovídající změny na úrovni proteomu i kdyţ se obojí v závislosti na vnějších vlivech mění (Ahuja, a kol., 2010, Kosova, a kol., 2011, Maksymiec, 2007, Yang, a kol., 2005).

16

3.2.3 Průběh stresové reakce u rostlin Průběh reakce rostliny na stres charakterizuje několik fází (Obrázek 1). Při první fázi, poplachové, je neaklimatizovaná rostlina vystavena poprvé stresu a míra tolerance klesá. Následuje fáze aklimatizační, trvající několik dní, při které dochází k postupnému obnovení homeostázy, přičemţ míra tolerance stoupá. Poté pokračuje fáze udrţovací, kdy je nově nastolená homeostáza udrţována a míra tolerance rostliny ke stresu se neustále vyrovnává v závislosti na podmínkách. Jestliţe působení stresu určitou dobu přetrvává, nastává fáze vyčerpání a k postupnému úhynu rostliny. Pokud stresové faktory přestanou působit ještě před odumřením, rostlina obnoví homeostázu, kterou měla před působením stresu (Cobbett a Goldsbrough, 2002, Kosova, a kol., 2011, Yadav, 2010). Rostliny si také vytvořili schopnost komunikace pomocí vylučování látek, které se šíří vzduchem a upozorňují ostatní rostliny na moţnost působení stresových faktorů (Arimura, a kol., 2005, Atkinson, 2000, Karl, a kol., 2008). Pomocí této schopnosti se mohou okolní rostliny připravit na potencionální nebezpečí zvýšenou metabolickou aktivitou a v okamţiku zasáhnutí stresového faktoru je jejich schopnost se přizpůsobit mnohem rychlejší, neţ u rostlin vystavených nebezpečí přímo (Baldwin, a kol., 2006, Farmer, 2001, Maksymiec, 2007, Villiers, a kol., 2011).

Obrázek 1: Průběh stresové reakce u rostlin. Obrázek upraven podle (Kosova, a kol., 2011).

17

Rychlé metabolické změny rostliny na stres jsou prováděny prostřednictvím exprese řady stresem-regulovaných genů (Fraser, a kol., 2002, Guerra, a kol., 2009, Herbette, a kol., 2006, Kielbowicz-Matuk, 2012, Zhou, a kol., 2012). Produkty těchto genů se řadí do dvou hlavních skupin, které jsou zapojeny do regulace genové exprese a v toleranci rostlinných buněk na variabilní stresové podmínky. První skupina zahrnuje geny, kódující regulační proteiny zapojené do signálních drah nebo do genové exprese indukované stresovým faktorem (Kielbowicz-Matuk, 2012). Mezi takové proteiny se řadí proteinové kinázy, fosfatázy, transkripční faktory a RNA-vázající proteinové komplexy. Do druhé skupiny patří proteiny umoţňující rostlině překonat a setrvávat ve stresovém prostředí, jako jsou detoxikační enzymy, enzymy potřebné pro biosyntézu osmoprotektantů, proteiny tvořící vodní kanály, nemrznoucí proteiny (AFP), chaperony a LEA proteiny uplatňující se při pozdní embryogenezi (Anderson a Anderson, 1998, Canovas, a kol., 2004, Desikan, a kol., 2001, Jorrin, a kol., 2007, Kiechle a HollandStaley, 2003, Kielbowicz-Matuk, 2012, Kosova, a kol., 2011). Rostliny také musí neustále udrţovat rovnováhu mezi výdejem a příjmem energie. Tato rovnováha (homeostáza) do značné míry závisí na signálních dráhách, které koordinují tři nejvíce kritické procesy v rostlinném ţivotě: i) fotosyntéza, ii) respirace a iii) fotorespirace (Ahuja, a kol., 2010, Jabeen, a kol., 2009, Maksymiec, 2007, Seth, a kol., 2012, Suzuki, a kol., 2012). Metabolické dráhy jsou citlivé na změny prostředí a metabolická nerovnováha můţe následně indukovat oxidativní stres generováním a akumulací reaktivních forem kyslíku (ROS – z ang. Reactive oxygen species) (Suzuki, a kol., 2012). ROS způsobují oxidaci buněčných komponent, čímţ brání metabolické aktivitě a zároveň narušuje biomembrány a tím integritu organel (Foyer, a kol., 1997, Liu, a kol., 2004, Suzuki, a kol., 2012, Wei, a kol., 2005). Oxidované metabolity a karbonylové proteiny jsou obecně povaţovány za markéry oxidativního stresu. Nyní se však ukazuje, ţe tyto sloučeniny hrají významnou roli i jako signální molekuly při oxidativním stresu (Akbarzadeh, a kol., 2012, Floris, a kol., 2009, Schutzendubel a Polle, 2002). Významnou roli v regulaci metabolizmu a energetické bilance v buňkách hraje i vzájemný vztah mezi různými organelami a jejich redoxního stavu (Rennenberg, 1982, Shah, a kol., 2010, Yadav, 2010). Elektron transportní řetězec v chloroplastech a mitochondriích je spojen s metabolismem uhlíku, přes který dochází k postupnému poklesu energie přenášených elektronů, coţ vytváří protonový gradient, který je následně vyuţit pro tvorbu NAD(P)H a ATP (Chaffai a Koyama, 2011, Dixon, a kol.,

18

1998, Nakashima, a kol., 2012, Rai, 2008, Villiers, a kol., 2011, Yang, a kol., 2005). Změny v metabolismu uhlíku a energetické rovnováhy při stresových podmínkách byly zaznamenány v chloroplastech i mitochondriích (Appenroth, 2010, Solanki a Dhankhar, 2011). Z uvedeného vyplývá, že k udržování toku energie přes tyto organely za různých růstových podmínek je vyžadována vysoká úroveň metabolické koordinace i proto, aby se předešlo nadměrné generaci ROS a oxidativního poškození (Suzuki, a kol., 2012). O vlivu a vzniku ROS (kapitola 3.5.5 v dalším textu).

3.2.4

Stres a exprese proteinů U rostlinných buněk vystavených abiotickému stresu dochází k celé řadě změn

na úrovni exprese proteinů (Frova, 2003, Kosova, a kol., 2011, Pal, a kol., 2006, Papoyan a Kochian, 2004, Schutzendubel a Polle, 2002, Yang, a kol., 2005). Zkoumání změn v proteomu je proto z hlediska jejich přímého vlivu na rostliny, velmi důležité (Anderson a Anderson, 1998, Canovas, a kol., 2004, Jorrin, a kol., 2007, Nallur, a kol., 2003, Templin, a kol., 2002). Proteiny nezahrnují pouze enzymy katalyzující změny metabolitů, ale i komponenty důležité pro transkripci a translaci a proteiny s přímým vlivem na změny v cytoplazmatické membráně, cytoplazmě, cytoskeletu a na ostatní intracelulární kompartmenty jako je buněčné jádro, mitochondrie, chloroplasty a ribozomy (Chuang, a kol., 2009, Hossain, a kol., 2012, Le Martret, a kol., 2011, Peng a Zhang, 2009, Zhang, a kol., 2012). Profil proteomu vzniklý pod vlivem stresového prostředí tedy určuje fenotypový projev rostliny. Jakákoli změna v akumulaci určitého proteinu v buňce však nutně nemusí znamenat, že genová exprese bude také zvýšena nebo potlačena, protože není zřejmá korelace mezi genovou expresí a konečným produktem syntézy proteinu (Olowoyo, a kol., 2012). Obecně však platí, že v důsledku syntézy proteinů při stresových podmínkách dochází i k nárůstu transkriptomu oproti normálnímu stavu. Stresové faktory ovlivňují expresi proteinů na několika úrovních (Olowoyo, a kol., 2012). Hlavními jsou translokace a post-translační modifikace proteinů. Distribuci proteinů v buňce ovlivňují sekreční dráhy a intracelulární interakce. Skupiny funkčně souvisejících proteinů jsou často regulovány v důsledku působení abiotického stresu. Proteiny zapojené do ochrany rostlinné buňky před účinky abiotických stresových faktorů ukazuje Tabulka 1 (Clemens, 2006, Hossain, a kol., 2012, Olowoyo, a kol., 2012, Singh, a kol., 2002).

19

Tabulka 1: Proteiny zapojené do ochrany rostlinné buňky před účinky abiotických stresových faktorů (Hossain, a kol., 2012). Proteinová skupina

Protein

osmoprotektanty

sukrózo syntáza, transportéry cuků

ROS

superoxidismutáza, askorbát peroxidáza, monodehydroaskorbát reduktáza, dehydroaskorbát reduktasa, glutathion peroxidáza, glutathion reduktáza, +

iontové transportéry

molekulární chaperony

proteiny souvysející s proteolýzou

Na /H +

Subcelulární umístění jádro, mitochondrie, chloroplasty, endoplazmatické retikulum, Golgiho, sucho, osmotický stres přístroje, cytoplazmatická membrána, buněčná stěna jádro, mitochondrie, chloroplast, zasolení, převodnění, peroxisomy, vakuola, sucho, chlad, teplo, endoplazmatické retikulum, Golgiho radiace aparát, cytoplazmatická membrána, buněčná stěna Abiotický stres

+

antiporty, membránové

H -ATPázy

zasolení, osmotický stres

cytoplazmatická membrána, tonoplast

jádro, mitochondrie, chloroplasty, HSPs, calnexin, calreticulin, BiP sucho, teplo, ozón, vakuola, (z ang. binding immunoglobulin osmotický stres, těžké endoplazmatické retikulum, Golgiho protein) kovy aparát, cytoplazmatická membrána, buněčná stěna cytoplazma, endoplazmatické ubikvitin zasolení, sucho retikulum, jádro

3.2.5 Signální dráhy a jejich role při stresových podmínkách Stresové signály jsou rozpoznávány a předávány, pomocí specializovaných signálních drah, do různých částí buněčných kompártmentů. V tomto procesu mají jednu z klíčových funkcí především protein kinázy a fosfatázy. Mezi proteinkinázy účastnící se transdukce stresového signálu u rostlin, které jsou stejné pro všechny eukaryotické organismy, patří MAP-kinázy (z ang. mitogen-activated protein kinases) – mitogenem aktivované protein kinázy glykogen syntáza kináza 3 (GSK3), S6 kinázy (S6K) (Huang, a kol., 2009, Kido, a kol., 2011, Kulik, a kol., 2011, Vij a Tyagi, 2007). Mezi proteinkinázy specifické pouze pro rostliny, patří kalcium-dependentní proteinkinázy (CDPKs), (z ang. calcium dependent protein kinesis) a většina tzv. SnRKs (z ang.SNF-1related protein kinase) (Harmon, a kol., 2000, Mori, a kol., 2006). Významnou úlohu hrají poslední jmenované SnRKs, které patří do rodiny SNF1/AMPK, která také zahrnuje SNF1 (sacharóza nonfermenting-1) kinázu z kvasinek Saccharomyces cerevisiae (Halford a Hey, 2009) a savčí AMPKs (AMPaktivované protein kinázy) (Davis, 2000, Pearson, a kol., 2001). AMPK byly původně definovány jako savčí protein kinázy alostericky aktivované 5´-AMP, schopného fosforylovat a inaktivovat syntézu enzymů lipidů a cholesterolu (Hall, 2002, Hu a Zhao, 2007, Kido, a kol., 2011, Kulik, a kol., 2011, Pal a Rai, 2010, Peralta-Videa, a kol., 2009, Schutzendubel a Polle, 2002, Solanki a Dhankhar, 2011, Suzuki, a kol., 2012,

20

Villiers, a kol., 2011). Mezi klíčové rostlinné proteinkinázy patří rodina serin/threonin specifická SnRK2, která se zapojuje do stresové odpovědi vyvolané abiotickými stresovými faktory a také ovlivňuje signální dráhy podmíněné kyselinou abscisovou (ABA) Obrázek 2. SnRK2s se rozděluje na tři skupiny (Agarwal a Jha, 2010, Kulik, a kol., 2011). První skupina zahrnuje kinázy, které nejsou aktivovány ABA. Druhá skupina zahrnuje kinázy neaktivované nebo jen velmi slabě aktivované kyselinou abscisovou. Třetí skupina se skládá ze tří kináz silně aktivovaných kyselinou abscisovou. Nejdůkladněji byly doposud zkoumány ABA-dependentní kinázy, patřící do třetí skupiny. Tyto kinázy se povaţují za hlavní regulátory rostlinné odpovědi na ABA (Boneh, a kol., 2012). Regulace odpovědi na ABA vede právě přes dráhu SnRK2s, která se uskutečňuje prostřednictvím přímé fosforylace různých downstream targetů jako např. SLAC1, KAT1, AtRbohF a transkripčních faktorů potřebných pro expresi mnoha genů stresové reakce (Brandt, a kol., 2012, Coello, a kol., 2012, Zhang a Gan, 2012). Kinázy z druhé skupiny se podílejí na některých buněčných funkcích společně s kinázami třetí skupiny, nicméně jejich přesný podíl a funkce, není doposud zcela objasněna. Vědci se však domnívají, ţe jsou pozitivními regulátory při vodním deficitu rostliny. S největší pravděpodobností také doplňují ABA-dependentní kinázy v obraně proti nepříznivým podmínkám prostředí. Fyziologická funkce ABAindependetních SnRK2 kináz je zatím nepopsána (Boneh, a kol., 2012, Coello, a kol., 2012, Garcia, a kol., 2012, Roelfsema, a kol., 2012).

21

Obrázek 2: Stresové faktory indukují tvorbu kyseliny abscisové (ABA), která se váţe na receptor. Díky vazbě na receptor, se můţe na komplex ABA-receptror vázat PP2C fosfatáza, která fosforylací umoţňuje ABF transkripčnímu faktoru iniciovat transkripci na ABA responzivnímu promotoru (ABRE) (Kim, a kol., 2004, Narusaka, a kol., 2003). Díky tomuto mechanizmu buňka začne syntetizovat obranné proteiny, které chrání buňku před stresovými faktory (Lee a Luan, 2012, Vankova, 2012).

22

Tabulka 2: Nejdůleţitější proteiny hrající roli při abiotickém stresu. Upraveno podle (Ahuja, a kol., 2010). GEN

PROTEIN

GEN

PROTEIN

ABAR

ABA-related

ITN1

Increased tolerance to NaCl1

ABI1

ABA Insensitive

LEA

Late embryogenesis abundant

AP37,59

APETELA 37, 59

LEW1

Leaf Wilting 1

At1g09350

Galactinol synthase (GolS3)

LOS2

Enolase 2/Low expression of osmotically responsive genes 1

At1g22985

AP2 -DNA binding protein

LTP3, 4

Lipid transfer protein 3, 4

At3g50970

Dehydrin xero2

miR169

MicroRNA 169A

At1g52690

LEA protein

MSI1

Chromatin modifying protein

At1g56600

Galactinol synthase, (GolS2)

MT2A

Metallothionein 2A

At1g69870

Proton-dependent oligopeptide transport

MYB96

MYB transcription factor 96

At1g80160

Lactoylglutathione lyase/glyoxalase 1

NCED3

Nine-cis-epoxycarotenoid dioxygenase 3

At3g53990

Universal stress protein

NFYA5

Nuclear factor Y A5

At3g55940

Phosphoinositide-specific phospholipase C

OCP3

Overexpressor of cationic peroxidase 3

At4g36010

Thaumatin family protein

OsABF1

O.sativaABA responsive element

ATHB-7

A.thalianahomeobox 7

OsDREB2A

O.sativaDREB protein 2A

BhHsf1

Boeahygrometricaheat shock factor

OsRMC

O.sativaroot meander curling

BiP

Binding protein

PAO

Polyamine oxidase

BOB1

BOBBER1

PF3-D, 5

Prefoldins 3 and 5

bZIP60

Basic domain/leucine zipper60

PIP2

Phosphatidylinositol 4,5-bisphosphate

CBK3

Calmodulin-binding protein kinase 3

PIPK

Phosphatidylinositolphosphate kinase

CcHyPRP

Cajanuscajanhybrid-proline-rich protein

PLD

Phospholipase D

COR

Cold Regulated

PLDa1

Phospholipase Da1

COR47

Cold Regulated 47

POX22.3,8.1

Peroxidases 22.3 and 8.1

DDF1

Dwarf and delayed flowering 1

PP2C

Protein phosphatase 2C

DELLA

Gibberellic acid signal mediators

PUB22, 23

Plant U-Boxes 22 and 23

DHN

Dehydrin genes

Rab16A

Rice ABA responsive gene 16A

DREB2A

Dehydration-responsive element

RBOHC&

Respiratory burst oxidase

binding protein 2

RBOHD

homologs C and D

DRIP1,2

DREB2A-interacting proteins 1, 2

RCA

Rubisco activase

DSM1

Mitogen-activated protein kinase kinase kinase

RCA1

Short isoform of RCA

ERF FLC

Ethylene response factor Flowering locus C

RD20 RD22

Responsive to desiccation 20 Responsive to desiccation 22

FTA

a-farnesyltransferase

RD29A,B

Responsive to desiccation 29A

FtsH11

Filamentous temperature-sensitive

Rma1H1

RING membrane-anchor 1 E3 ubiquitin ligase

binding factor 1

23

GA2ox7

Gibberellic Acid 2-oxidase 7

ROF1

Rotmase FK506 Binding Protein 1

GH3

auxin conjugating enzyme

RPN12a

Regulatory particle non-ATPase 12a

GmWRKY

G.maxWRKY transcription factor

SAL1

3’(2’), 5’-biphosphate nucleocidase

G protein

GTP-binding protein

Ser 228

Autophosphorylation site of SOS2

GRP7

Glycine-rich protein 7

SODs

Superoxide dismutases

GSNOR

S-nitrosoglutathione reductase

SOR

Superoxide reductase

HKT1;1

High affinity potassium transporter 1

SOS2

Salt Overly Sensitive 2

HOS3

Hyper-osmotically sensitive gene

TaSnRK2.4

T.aestivumserine/threonine protein kinase

HOT5

Sensitive to hot temperatures

TdDHN

T.durumdehydrins

HPR1

Hydroxypyruvate reductase

TOC1

Timing of CAB expression 1

HSFA1a

Heat Shock Factor 1A

TsVP

ThellungiellahalophilaV-H+-PPase

HsfA3

Heat Shock Transcription Factor A3

V-H+-PPase

Vacuolar H+-pyrophosphatase

HvCBF4

HordeumvulgareC-repeat binding factor 4

V-ATPase

Vacuolar H+-ATPase

InsP5-ptase

Inositol polyphosphate 5-phosphatase

WLIP19

Wheat low-temperature induced protein 19

ISPS

Isoprene synthase

24

3.2.6 MikroRNA MikroRNA (miRNA) jsou malé nekódující RNA hrající důleţitou roli při regulaci genové exprese. miRNA vzniká z pre-miRNA, vlásenek, vzniklých z pri-miRNA v jádře. pre-miRNA je následně v cytoplazmě upravena endonukleázou Dicer na miRNA vstupující do komplexu RISC, který ovlivňuje expresi genů. (Dicer patří do rodiny ribonukláz III) (Zhu, a kol., 2011). Funkce miRNA je ve schopnosti umlčovat (silencing) posttranskripčně geny, vazbou na konkrétní mRNA, čímţ navodí jejich degradaci nebo umoţní zabránit v jejich translaci v proteinu (He a Hannon, 2004, Sunkar, 2010, Zhu, a kol., 2011) (Obrázek 3).

Obrázek 3: Vznik a funkce miRNA. Modře vyznačené jádro, kde za účasti nukleázy Drosha, dochází ke vzniku Pre-miRNA z Pri-miRNA, kódované mRNA. Pre-miRNA je v cytoplazmě endonukleázou Dicer přeměněna na dvou-řetězcovou miRNA, která se dál

25

štěpí na jednotlivé miRNA. Jedno-vláknové miRNA se pak váţí do komplexu RISC (RNA-induced silencing complex), který je schopen umlčovat expresi genů. V rostlinách, miRNA přímo interagují s mRNA prostřednictvím dokonalé nebo téměř dokonalé komplementarity bází (Sunkar, 2010). Rostlinné miRNA se účastní důleţitých vývojových procesů všech rostlinných orgánů, tj. ontogeneze květu, listu, stonku a kořene (Sunkar, 2010). Rostlinné miRNA hrají i významnou úlohu v reakci rostlin na stres (Ding, a kol., 2011). Mezi takové miRNA patří miR395 (Guddeti, a kol., 2005, Kawashima, a kol., 2011). Experimenty ukázaly, ţe při deficitu síry v ţivném médiu se její mnoţství ve sledovaném vzorku zvyšovalo. Současně byly objeveny další miRNA, které mají podobnou odezvu při deficitu fosfátu (miR399) (Chiou, a kol., 2006). Vzhledem k tomu, ţe jsou rostliny vystaveny několika různým stresovým faktorům naráz, byly hledány miRNA, které by reagovaly na více stresových podnětů. Takovou miRNA je miR393, jejíţ mnoţství reaguje na vysoké zasolení, dehydrataci, chlad či na hladinu ABA v rostlině (Ding, a kol., 2011, Gao, a kol., 2011, Hou, a kol., 2011, Vidal, a kol., 2010). Další takovou miRNA je miR398, která je ovlivňována mnohem větším počtem různých abiotických ale i biotických stresových faktorů, mezi něţ patří, deficit Cu a fosfátu, oxidativní stres, ultrafialové záření, salinita, kyselina abscisová, dehydratace a působení rostlinných patogenů (Ding, a kol., 2011, Ding, a kol., 2011, Hou, a kol., 2011, Huang, a kol., 2009, Jagadeeswaran, a kol., 2009, Zhou, a kol., 2012, Zhu, a kol., 2011). Některé nejdůleţitější miRNA jejich funkci a rodinu ukazuje Tabulka 3.

26

Tabulka 3: Některé miRNA vyskytující se u A. thaliana a jejich regulační funkce (Xie, a kol., 2005, Yang, a kol., 2007). miRNA rodina ovlivněné proteiny

funkce

miR156 a-f

regulace květů a kvetení

SBP-like TFs

UGACAGAAGAGAGUGAGCAC miR159/JAW

MYB TF, TCP TFs

vývoj listů a embryogeneze

miR160 a-c

ARF TFs

signální molekula auxinů a vývoj kořenů UGCCUGGCUCCCUGUAUGCCA

miR164 a-b

NAC-doména TFs

vývoj orgánů

UGGAGAAGCAGGGCACGUGCA miR165/166

vývoj embrya, regulace orgánové polarity

HD-ZIP TFs

UCGGACCAGGCUUCAUCCCCC/UCGGACCAGGCUUCAUUCCCC miR168 a-b

regulace drah malých RNA

AGONAUTE

UCGCUUGGUGCAGGUCGGGAA miR172 a-b

APETALA2-like TFs

specifikace květních orgánů a regulace kcvetení

AGAAUCUUGAUGAUGCUGCAU miR173 a

TAS

biogeneze siRNA UUCGCUUGCAGAGAGAAAUCAC

miR393 a-b

F-box, protein UCCAAAGGGAUCGCAUUGAUC

miR394 a-b

F-box protein UUUGGCAUUCUGUCCACCUCC

miR395 a, d-e ATP sulfurylase

regulace asimilace síry

CUGAAGUGUUUGGGGGAACUC miR396 a

GRL TFs UUCCACAGCUUUCUUGAACUG

miR397 a

Laccase Beta-6 tubulin UCAUUGAGUGCAGCGUUGAUG

MiR398 a

CSD CytC oxidaser

regulace oxidativního stresu

UGUGUUCUCAGGUCACCCCUU miR399 a

UBC

reguklace při nedostatku sulfátů UGCCAAAGGAGAUUUGCCCUG

miR390 a-b

TAS AAGCUCAGGAGGGAUAGCGCC

27

3.3 Příjem a transport kovů rostlinou Toxické a těžké kovy jsou jedním z hlavních abiotických stresových faktorů působící a ovlivňující vitalitu rostlin (Shah, a kol., 2010, Yang, a kol., 2011). Rostliny se do prvního kontaktu s potenciálně nebezpečnými látkami dostávají při klíčení, při kterém jsou vysoce citlivé na změny prostředí (Solanki a Dhankhar, 2011). Během klíčení jsou čerpány zásoby živin ze semen. Metabolické změny způsobené vlivem těžkých kovů ovlivňují aktivitu hydrolytických enzymů, štěpící zásobní škrob na cukry, jenž potřebuje embryo k vývoji do té doby, než se stane autotrofním (Solanki a Dhankhar, 2011). Rostliny však mají vysokou schopnost adaptovat se na nepříznivé podmínky prostředí díky komplexním mechanizmům jako je transdukce a transmise signálu, respektive stresového stimulu (di Toppi a Gabbrielli, 1999, Prasad, 1995, Schutzendubel a Polle, 2002, Singh, a kol., 2002). Dospělá rostlina absorbuje těžké kovy především pomocí kořenového systému společně s dalšími esenciálními prvky. Celý proces je závislý na koncentračním gradientu indukovaného selektivním příjmem iontů kořeny nebo volnou difúzí prvků do půdy. Množství příjmu iontů těžkých kovů také závisí na druhu rostliny (Guerra, a kol., 2009, Rascio a Navari-Izzo, 2011, Schutzendubel a Polle, 2002). Růst a vývoj rostlin vyžaduje nejen makronutrienty (N, P, K, S, Ca a Mg), ale také základní stopové prvky jako je Fe, Zn, Mn, Ni, Cu a Mo, které mohou být ve vyšších koncentracích toxické (Abou Auda a Ali, 2010, Jabeen, a kol., 2009). Ačkoliv mechanizmus membránového transportu kovů je selektivní, neesenciální kovy jako As nebo Cd, jsou přijímány a transportovány stejným mechanizmem (Rascio a Navari-Izzo, 2011, Seth, a kol., 2012). Rostliny pro příjem, distribuci nebo redistribuci prvků uplatňují různé strategie, které jim umožňují udržovat rovnováhu vnitřního prostředí (homeostázu) (FilipovicTrajkovic, a kol., 2012). Je známo, že z důvodu snadnějšího vstřebávání, rostliny zvyšují

rozpustnost

a

mobilitu

prvků.

Využívají

k tomu

polysacharidy,

polygalakturonovou kyselinu, slizovité látky, organické kyseliny, aminokyseliny a fenolické látky uvolněné rostlinou z kořenů. Buněčná stěna je první překážkou bránící vstupu TK do rostlinných buněk. V buněčné stěně interagují TK zejména s polysacharidy (pektiny) (Rai, 2008). Tyto reakce však nejsou přímo regulovány. Transport TK dál do buňky přes cytoplazmatickou membránu se děje změnou koncentrace H+ iontů a iontového gradientu a pomocí transportních kanálků vyžadující

28

energii (Lux, a kol., 2011). Transport kovových iontů přes membrány můţe také záviset na přítomnosti karboxylových kyselin (kyselina citronová nebo jablečná) a dalších látek, které jsou schopny chelatovat ionty kovů (Memon a Schroder, 2009). Pokud bychom se chtěli podívat na transport TK v rámci celé rostliny, zjistíme, ţe problematika není dosud zcela komplexně objasněna. Pravděpodobně však dochází k transportu pomocí xylému a floému. Rostliny disponují malými moţnostmi, jak se zbavovat TK do okolního prostředí, coţ se můţe dít exsudací přes kořeny, transportem do trichomů nebo do vývojově nejstarších listů (Cramer, a kol., 2011, Hall, 2002, Kupper a Kroneck, 2005, Rascio a Navari-Izzo, 2011, Seregin a Kozhevnikova, 2011, Xiang a Oliver, 1998). Z uvedeného lze odvodit, ţe se rostlina snaţí, TK začlenit či uvolnit způsobem pro ni nejméně nebezpečným (Supalkova, a kol., 2007). Obrázek 4. zobrazuje příjem TK rostlinou.

Obrázek 4: Schéma příjmu a transportu těţkých kovů z kořene do listů. Obrázek ukazuje zapojení jednotlivých transmembránových proteinů, které jsou zapojeny do příjmu, translokaci a uloţení TK do vakuol (jak se zejména děje u hyperakumulujících rostlin). Vysvětlivky: CAX = kationtový přenašeč, CDF = transportéry (z ang. cation diffusion facilitator, FDR3 = transportér patřící do rodiny proteinů, transportující

29

toxiny; TK = těžké kovy; HMA = transportér typu P, ATPasy pro přenos těžkých kovů (z ang. heavy metal ATPases); NA = nikotinamin, NIP = akvaporin (z ang. Nodulin-26like intrinsic proteins), P = fosfátové transportéry, S = síranové transportéry, YSL = z (ang. Yellow Strip 1-Like Proteins), ZIP = transportéry zinku a železa (z ang. Zinc-regulated transporter Iron-regulated transporter Proteins) Obrázek upraven podle (Rascio a Navari-Izzo, 2011). 3.3.1

Příjem kademnatých iontů

Velká pozornost je věnována iontům kadmia, ale i olovu a rtuti, kvůli jejich závažným fytotoxickým účinkům a schopnosti rostlin je společně s dalšími nutriety snadno přijímat (Olowoyo, a kol., 2012). Mezi velmi nebezpečné kovy je také řazen díky jeho velké mobilitě a schopnosti škodit již při velmi malé koncentraci. V současnosti

je

poměrně

dobře

prostudována

molekulární

podstata

příjmu

kademnatých iontů rostlinnými buňkami (Ahsan, a kol., 2009, Hasan, a kol., 2009). Kademnaté ale i olovnaté ionty vstupují do rostliny hlavně přes kořenový systém (Lux, a kol., 2011). V menší míře jsou přijímány i prostřednictvím listů (Shah, a kol., 2010, Supalkova, a kol., 2007). Na povrchu kořene se kademnaté i olovnaté ionty (Cd2+ a Pb2+) vážou na karboxylové skupiny se záporným nábojem (COO-) kyseliny polygalakturonové, která společně s dalšími polysacharidy vytváří slizovou vrstvu na povrchu kořene. Slizové látky nejlépe interagují s ionty Pb2+ pak Cu2+, Cd2+ a nejhůře s ionty Zn2+ (Melo, a kol., 2011, Noctor a Foyer, 1998, Prasad, 1995). Slizová vrstva na kořenu tak výrazně omezuje vstup těchto kovů do transportního systému rostliny. Nicméně při biodegradaci slizové vrstvy může část iontů Pb a Cd rostlina přijmout (Abou Auda a Ali, 2010, Melo, a kol., 2011) Obecně příjem těžkých kovů závisí na pH půdy, na obsahu organické hmoty a koncentraci dalších iontů v půdě (Kupper a Kroneck, 2005). Při vyšších hodnotách pH, rozpustnost kademnatých solí v půdním roztoku klesá, kvůli tvorbě nerozpustných sloučenin, čímž klesá i biologická dostupnost Cd2+ iontů. Chelatace iontů Cd2+ (EDTA) zvyšuje jejich přístupnost pro rostliny (Najmanova, a kol., 2012). Příjem Cd2+ také ovlivňují další ionty kovů (Hasan, a kol., 2009, Prasad, 1995). U kořenů fazolí byla inhibice příjmu Cd2+ způsobena kovy alkalických zemin a samotnými alkalickými kovy. Největší vliv pak mají vápenaté ionty (Ok, a kol., 2011, Wu, a kol., 2011). Zde byla pozorována jak výrazná inhibice tak i u

30

kořenů bříz stimulace příjmu Cd2+, přestože koncentrace vápníku v kořenových pletivech neovlivňovala rychlost příjmu Cd2+ (Gunawardana, a kol., 2010, Ok, a kol., 2011, Seo, a kol., 2006). Koncentrace Fe iontů, která příjem Cd iontů snižuje (Kupper a Kroneck, 2005, Wei, a kol., 2005). U Hordeum vulgare bylo pozorováno, že koncentrace Fe2+ 0-10 µM snižuje příjem Cd iontů (Noctor a Foyer, 1998, Olowoyo, a kol., 2012, Xiang a Oliver, 1998). U Thlaspi caerulescens cv Ganges docházelo při deficitu železnatých iontů avšak s obsahem iontů kademnatých v půdním roztoku k expresi genů zodpovědných za příjem Fe iontů, čímž docházelo k příjmu iontů kadmia (Lombi, 2002) (Rigola, a kol., 2006). Také u Arabidopsis halleri dochází k příjmu Cd iontů z média do xylému společně s transportéry iontů zinku nebo železa (Ueno, 2008). U rostlin (Zea mays) vystavených Cd iontům a naopak deficitu Fe iontů, se zvyšovalo množství fytosideforů (kyselina deoxymugineová) vylučovaných z kořenů (Lagriffoul, a kol., 1998, Vamerali, a kol., 2010). Tyto látky chelatují ionty Cd a vytváří tak komplexy umožňující příjem Cd a Fe iontů. Vzhledem k tomu, že u pšenice jsou ionty Cd uloženy ve vakuolách kořenových buněk vázané na fytochelatiny, se předpokládá, že fytochelatiny ovlivňují symplastický transport Cd iontů (Hinesly, a kol., 1984, Tester a Leigh, 2001). Transport Cd iontů uvnitř rostliny se děje za pomocí málo afinitního kationtového transportéru. (LCT1) odpovědného za transport Ca iontů ve pšenici, ale také zodpovědného za transport Cd iontů v kvasinkách Pichia pastoris (Hasan, a kol., 2009, Ramos, a kol., 2002). Je velmi pravděpodobné, že tento transportér se také podílí na transportu Cd iontů u mnoha dalších rostlin. U Arabidopsis byl také zjištěn gen ZntA lokalizovaný na cytoplasmatické membráně, který se podílí na transportu Cd iontů z kořenů do nadzemních částí rostliny (Lagriffoul, a kol., 1998, Prasad, 1995). U Zea mays se zdá být vstup Cd iontů do symplastu kořene neregulovaný, zatímco jeho translokace do nadzemní části je nějakým způsobem řízena a regulována pomocí doposud neznámých faktorů (Hinesly, a kol., 1984). Salsola kali, potenciální hyperakumuátor Cd iontů, využívá k jejich vazbě nízkomolekulárních tiolových látek (LMWT - z ang. low molecular weight thiols), tvořených především v kořenech a stoncích a také z velké části i v listech. Kademnaté ionty soutěží o stejné transmebránové přenašeče společné pro mikro a makronutrienty jako je K, Mg, Mn, Cu, Zn, Ni, Ca (Rivetta, a kol., 1997). Buněčné membrány přispívají k udržení homeostázi kovů tím, že zabraňují nebo redukují jejich vstup do buňky. Epidermis kořenů a kortex je apoplastickou cestou dobře propustný pro rozpuštěné látky. Pokračování apoplastické

31

difúze dál do vaskulárního systému rostliny je znemoţněno buněčnou stěnou endodermálních buněk obsahující vrstvu suberinu (Casparyho prouţky) (Clemens, 2001, Clemens, 2006). Aby mohly rozpuštěné látky vstoupit do xylému, musí být nejdříve transportovány z apoplastického transportního systému do symplastického transportního systému. Tento transport zprostředkovaný sekundárními transportéry řídí gradient elektrochemického potenciálu cytoplazmatické membrány v epidermálních kořenových buňkách (Clemens, 2001, Ramos, a kol., 2002). Membránový potenciál je negativní na straně cytoplazmatické membrány a můţe přesáhnout hodnotu -200 mV (Hirsch, a kol., 1998). Navzdory odlišné mobilitě iontů kovů je jejich mnoţství obecně větší v kořenech, neţ v nadzemních částech rostliny. V mnohých environmentálních podmínkách Cd2+ vstupuje do rostliny nejdříve kořeny, a proto nejdříve škodí zde. Normálně se Cd ionty udrţují v kořenech a pouze malé mnoţství vstupuje do nadzemní části. Obecně mnoţství Cd klesá v pořadí: kořeny, stonek, listy, plody a semena (Hasan, a kol., 2009, Lagriffoul, a kol., 1998, Vamerali, a kol., 2010)

3.4 Vliv těţkých kovů na rostliny Těţké kovy ovlivňují rostliny na několika úrovních především to je růst, dělení buněk, struktura chromozomů, buněčné membrány, fotosyntetický aparát (Hajduch, a kol., 2001). Fotosyntéza je jedna z klíčových metabolických drah. Působením TK dochází k degradaci nebo fragmentaci některých proteinů či enzymů účastnících se metabolických

drah

fotosyntézy

včetně

enzymu

ribulosa-1,5-bisfosfát-

karboxylása/oxygenása (RuBisCO) (Stiborova, 1988, Stiborova, a kol., 1986, Stiborova, a kol., 1986). U kořenů rýţe vysoká koncentrace Cd iontů silně indukovala expresi regulačních proteinů jako je ER1 receptor pro kinázy a cytokinin oxidázy, a některých dalších enzymů, jako je cynnamyl-alkoholdehydrogenáza, zatímco exprese proteinů související s ATP byla sníţena (Aina, a kol., 2007). Citlivost rostlin k těţkým kovům nezávisí jen na jejich druhu a koncentraci, ale i na tom v jaké vývojové fázi se rostlina nachází (Marques, a kol., 2009). Antioxidační látky u klíčících semen rýţe byly výrazně up-regulovány při působení Cd iontů, coţ naznačuje, ţe tyto proteiny spolupracují na vytváření nové homeostázy (Aina, a kol., 2007). Mnohem intenzivnější výzkum probíhá u rostlin dvouděloţných (Arabidopsis thaliana) na rozdíl od rostlin jednoděloţných (Aina, a kol., 2007). U Arabidopsis thaliana byl identifikován velký soubor rozdílně

32

exprimovaných proteinů, na základě jejich analýzy se dospělo k závěru, ţe hlavní reakcí buněk A. thaliana na ionty Cd byla aktivace metabolismu uhlíku, dusíku a síry, čímţ se spustila syntéza fytochelatinů (PC) nebo jejich prekurzorů- glutationu GSH (Zhen, a kol., 2007). Účinky Cd iontů byly zkoumány i u mladých stromů topolu (Kieffer, a kol., 2008). Na základě jejich výsledků bylo zjištěno, ţe ionty Cd mají váţný dopad na Calvinův cyklus, elektrontransportní systém ve fotosyntéze, na enzym RuBisCO, dále ovlivňuje protein OEE1 z ang.oxygen-evolving enhancer protein 1 coţ je manganstabilizující protein (manganesestabilizing protein - MSP), který je hlavní vnější protein OEC (centrum vyvíjející kyslík – z ang. oxygen evolving center) nacházející se ve všech známých fotosyntetizujících organismech vyvíjejících kyslík (oxyfototrofech) (Fecht-Christoffers, a kol., 2003). Kademnaté ionty také ovlivňovaly ferredoxinNADP1 a oxidoreduktásy. Prováděny byly i studie u niţších a hyperakumulujících rostlin. V řasách bylo vlivem iontů Cd mnoţství proteinů zapojených do fotosyntézy, Calvinova cyklu a biosyntézy chlorofylu významně sníţeno. Zatímco proteiny zapojené do biosyntézy GSH a metabolismu ATP byly v důsledku působení Cd iontů výrazně zvýšeny. U kov-hyperakumulujících rostlin jako je Thlaspi caerulescens, bylo zjištěno, ţe antioxidační proteiny mohou být zodpovědné za zvýšení tolerance rostliny k iontům těţkých kovů (Ahsan, a kol., 2009, Tuomainen, a kol., 2006). 3.4.1 Genová exprese a kademnaté ionty Regulace genové exprese v reakci na působení Cd iontů se zdá být spíše časově regulována neţ koncentrací Cd iontů (Agarwal a Jha, 2010, Desikan, a kol., 2001). Geny regulované působením Cd iontů lze rozdělit do několika skupin proteinů. Jedná se o proteiny zprostředkovávající či účastnící se při transdukci signálu, regulaci transkripce, transportu kovů, fotosyntetických procesů, metabolismu buněčné stěny, vodní bilanci, fotosyntetických procesů, ochraně před ROS, opravných mechanismech, metabolismu síry a GSH (Frova, 2003). Velká skupina genů, aktivovaných Cd ionty, kóduje transkripční faktory z rodin WRKY, bZip a MYB a proteiny zapojené do signálních drah (Eulgem a Somssich, 2007, Kovalchuk, a kol., 2005). Další geny zapojené do ochrany rostliny před Cd ionty souvisí s detoxifikačními a opravnými mechanismy kam se řadí chitinázy, proteiny teplotního šoku (HSP – z ang. Heat shock protein) zodpovědné za sekundární ochranu proti stresu vyvolaného kovy (Hightower,

33

1991, Lindquist a Craig, 1988). Transgenní rostliny exprimující houbové chitinázy projevují výrazně lepší toleranci k těţkým kovům. HSP se převáţně exprimují při tepelném stresu přičemţ působí jako molekulární chaperony umoţňující transportovat proteiny do organel a chránit je před agregací (Neumann, a kol., 1994). Indukci HSP, ionty kadmia, mohou regulovat molekuly peroxidu vodíku (H2O2) společně s transkripčními faktory mající schopnost rozeznávat a aktivovat se právě pomocí H2O2 (Ben Fredj, a kol., 2010, Ma, a kol., 2012). Některé z genů regulovaných ionty Cd jsou zapojeny do transportu Cd například AtPcr1 patřící do genové rodiny ABC nebo gen AtPDR8 kódující proteinovou pumpu pro ionty Cd (Kim, a kol., 2007, Song, a kol., 2004). Dalším genem je AtOSA1, který je zapojen do signální transdukce v reakci na oxidativní stres, mimo jiné, vyvolaný i těţkými kovy (Jasinski, a kol., 2008). Gen Cdl19 kóduje proteiny schopné vázat Cd ionty a udrţovat homeostázu, či je zapojen do detoxifikace. Vzhledem k tomu, ţe ionty Cd mají na rostlinu největší vliv v podobě produkce ROS tak i počet genů zapojených do ochrany proti ROS je značný počet (Farinati, a kol., 2010, Induri, a kol., 2012, Park, a kol., 2012). U Arabidopsis thaliana jich zatím bylo identifikováno nejméně (Mittler, a kol., 2004). Zvláštním typem ROS je peroxid vodíku, který při vyšších mnoţstvích způsobuje značné poškození organizmu, ale při niţších koncentracích je zapojen do buněčné signalizace (Apel a Hirt, 2004). 3.4.2 Transkripční faktory Stresové faktory ovlivňují rostlinné geny především na úrovni transkripce, která je regulována časově i prostorově specifickými geny kódující transkripční faktory, jeţ jsou důleţitou součástí odpovědi rostlin na stres. Jenom A. thaliana má více neţ 1500 transkripčních faktorů (Singh, a kol., 2002). Stále je mnoho otázek kolem regulace transkripčních faktorů stresovými faktory, jako jsou těţké kovy. Reakce rostliny na těţké kovy se děje prostřednictví přenosu signálu, který nakonec indukuje transkripci. (Gao, a kol., 2002). Teprve nedávno bylo moţné pomocí expresních analýz identifikovat transkripční faktory, reagující na přítomnost těţkých kovů, ale i na dehydrataci, peroxid vodíku, chlad a ostatní abiotické faktory (Fusco, a kol., 2005). Mezi hlavní transkripčních faktorů interagující s těţkými kovy patří i) ERF transkripční faktory (z ang. ethylene-responsive-element-binding factor) (Son, a kol., 2012); ii) bZIP (z ang. basic-domain leucine-zipper) (Jakoby, a kol., 2002); iii) WRKY transkripční

34

faktory, které mají konzervovanou aminokyselinovou sekvenci (tryptofan, arginin, lyzin, tyrozin) (Eulgem, a kol., 2000). 3.4.2.1 ERF transkripční faktory ERF transkripční faktory (ERF Tf) patří do rodiny APETALA2 (AP2) rodiny (Singh, a kol., 2002). Zatím bylo objeveno u A. thaliana 124 ERF transkripčních faktorů. Ionty kadmia indukují geny ERF 1 a ERF2 u kořenů A. thaliana po 2 hodinách působení. (Berrocal-Lobo, a kol., 2002, Weber, a kol., 2006). Krom toho, ţe ERF Tf reagují na Cd ionty, se váţí i na DRE elementy, které jsou spojeny s odpovědí rostlin na dehydrataci. S motivy DRE specificky interaguje DREB2A v promotorové oblasti rd29A a u rostlin vystavených iontům kadmia aktivuje jejich transkripci (Narusaka, a kol., 2003, Son, a kol., 2012). Zatím nebyl pozorován fenotypový projev rostlin při ztrátě nějakého ERF genů, coţ můţe být také způsobeno tím, ţe jednotlivé rodiny transkripčních faktorů se v mnohých funkcí překrývají a mohou se mezi sebou nahrazovat (di Toppi a Gabbrielli, 1999, Jin, a kol., 2010). 3.4.2.2 bZIP transkripční faktory Významnou skupinou transkripčních faktorů je rodina bZIP, která má u A. thaliana 75 členů (Jakoby, a kol., 2002). Jedna z nejdůleţitějších skupin bZIP transkripčních faktorů, které jsou regulovány i těţkými kovy jsou OBF proteiny (z ang. octopine synthase-element-binding factor) (Kang a Singh, 2000, Subramaniam, a kol., 2001). OBF transkripční faktory regulují, mimo jiné, expresi genu GLUTHATION STRANSFERÁZA6 (GST6) (Chen a Singh, 1999). Kademnaté ionty mají vliv na OBF5 Tf, který se váţe na promotorovou oblast GST6 genu. Exprese BjCdR15 transkripčního faktoru je u Brukve sítinovité (Brasica juncea L.) indukována jiţ při krátkém působení Cd iontů (Farinati, a kol., 2010, Fusco, a kol., 2005). Tento transkripční faktor kontroluje expresi několika transportérů kovů, které jsou zapojeny i do transportu iontů kadmia z kořene do nadzemních částí rostlin. Overexprese BjCdR15 transkripčního faktoru u A. thaliana a rostlin tabáku zvyšuje jejich toleranci k iontům kadmia (Farinati, a kol., 2010).

35

3.4.2.3 WRKY transkripční faktory WRKY transkripční faktory jsou specifické jen pro rostliny a u A. thaliana jich bylo doposud objeveno 74. Jedná se o poměrně novou rodinu Tf. WRKY proteiny se skládají se z jedné nebo ze dvou domén (Eulgem a Somssich, 2007, Robatzek a Somssich, 2001, Son, a kol., 2012). Transkripční faktor WRKY53 byl studován u rostlin penízku modravého (Thlaspi caerulescens) vystavených iontům kadmia. Tento Tf je ovlivňován i jinými stresovými faktory jako je salinita, sucho, chlad. Jeho zásadní funkce je však v regulaci ostatních Tf zapojených do signálních drah. Fenotyp u rostliny s mutací AtWRKY6 nevykazoval ţádné odlišnosti od kontrolních rostlin, avšak docházelo ke změně exprese genů zapojených v ochraně a senescenci (Robatzek a Somssich, 2002, Yu, a kol., 2001).

3.5 Fytoremediace Nápad, vyuţít rostliny pro ošetření či remediaci kontaminované půdy je velmi starý. Pokud se podíváme na vědeckou databázi Web of science a zadáme heslo fytoremediace, první zmínka v odborné publikaci pochází z roku 1993. Přesto je velmi těţké vysledovat jakékoliv další zdroje o zrození tohoto nápadu. V současnosti díky velké škále výzkumných záměrů, vědeckých objevů a nových technologií se ukazuje vyuţívání rostlin a jejich rhizosférických bakterií jako slibný nástroj v boji proti ekologickým katastrofám způsobených jak člověkem, tak samotnou přírodou (Lux, a kol., 2011, Padmavathiamma a Li, 2007, Shi, a kol., 2009, Wood, 2008). Fytoremediační techniky se dnes vyuţívají zejména pro dekontaminaci půd a usazenin a ozdravování podzemních i povrchových vod, i přesto, ţe mají některá svá omezení (Marques, a kol., 2009, Padmavathiamma a Li, 2007, Seth, a kol., 2012). Výhodou remediace na rostlinné bázi je jejich fungování s minimální údrţbou a celkově s niţšími náklady a to v průměru aţ 10 krát, ve srovnání s odbagrováním a nahrazením kontaminované půdy za půdu novou (Rascio a Navari-Izzo, 2011). Mezi další výhody patří malý dopad na ţivotní prostředí v místě znečištění (Padmavathiamma a Li, 2007). Nezodpovězenou otázkou však stále zůstává, jak efektivně naloţit s rostlinami po ukončení fytoremediace. Problémem pouţití dřevin pro fytoremediace jako je topol, je v opadu listů, které mohou zpět do půdy uvolnit část jiţ naakumulovaných polutantů

36

(Dai, a kol., 2011, Houdebine, 2007, Yadav, a kol., 2010). Nicméně o transportu těţkých kovů do listů, zatím stále chybí podrobnější studie. Dále je vyuţití fytoremediačních technik omezeno klimatickými a geologickými podmínkami, teplotou, nadmořskou výškou, typem půdy a v neposlední řadě i dostupností terénu pro zemědělskou techniku (Peris, a kol., 2008).

3.5.1 Hyperakumulátory Hyperakumulující rostliny dokáţí absorbovat vysoké mnoţství (v koncentraci 100 – 1000 krát vyšší neţ běţné rostliny) jednoho nebo více druhů těţkých kovů a navíc, absorbované kovy transportovat do nadzemních částí rostlin a neuchovávat je v kořenech jak to dělají ne-hyperakumulující rostliny (Rascio a Navari-Izzo, 2011). Hyparakumulující rostliny také nevykazují téměř ţádné náznaky fytotoxicity. Zásadní vlastností umoţňující těmto rostlinám přeţít vysoké koncentrace těţkých kovů je vysoká míra tolerance (hypertolerance) (Rascio a Navari-Izzo, 2011, Shah a Nongkynrih, 2007). Obrázek 5 ukazuje rozdíl mezi hyperakumulující rostlinou a rostlinou, nevlastnící tyto vlastnosti.

37

Obrázek 5: Rozdíl mezi hyperakumulující rostlinou a rostlinou, která tyto schopnosti nemá. Jednotlivá čísla znázorňují: (1) těţké kovy se váţou do buněčné stěny a/nebo interagují s buněčnými exsudáty; (2) příjem těţkých kovů kořeny; (3) chelatace těţkých kovů v cytosolu a/nebo jejich uloţení do vakuol; (4) translokace do nadzemních orgánů. Tečky pak zobrazují orgány, ve kterých dochází k jednotlivým reakcím a zároveň podle jejich velikosti odráţí koncentraci těţkých kovů v daném orgánu. Upraveno podle (Rascio a Navari-Izzo, 2011) 3.5.2 Mechanismus účinku Rostliny mají řadu mechanismů na buněčné úrovni, která jsou zapojeny do detoxikace a tolerance ke stresu způsobeným těţkými kovů (Marques, a kol., 2009, Perales-Vela, a kol., 2006). Kdyţ se kovy hromadí v pletivech, často způsobují toxicitu, a to jak přímo poškozením buněčných struktur nebo nepřímo nahrazením jiných základních ţivin. V závislosti na remediační strategii lze fytoremediace rozdělit na fytostabilizaci, fytoextrakci a fytovolatilizaci. (Thangavel a Subhuram 2004, Taiz a

38

Zeiger, 2002) Obrázek 6. Při fytostabilizaci dochází k zastavení šíření kontaminantu do okolního prostředí, coţ je docíleno bariérou vytvořenou kořeny rostlin (Cunningham a Berti, 2000, Toderich, a kol., 2010). Při fytovolatizaci dochází k příjmu kontaminantu kořenovým systémem rostliny a transportu do nadzemní části, v některých případech ještě následovaný biotransformací kontaminantu (Edwards, a kol., 2011, Wang, a kol., 2012). Poté proběhne transpirace těkavého kontaminantu, těkavého produktu metabolismu nebo těkavé formy původně netěkavé látky (Cheng, 2003). Některé mikroorganismy mohou enzymaticky redukovat rtuťnaté ionty na kovovou rtuť, která se díky svým fyzikálním vlastnostem rozptyluje do okolí ve formě par (Kumar, a kol., 1995). Gen kódující reduktázu rtuti se podařilo vnést do genomu rostliny Arabidopsis thaliana, a také do rostliny Lyriodendron tulipifera. Expresí tohoto genu se zvýšila odolnost rostlin vůči koncentraci Hg2+ iontů v jejich tkáních a současně se podařilo převést větší část rtuti ve formě Hg0 do ovzduší (Marques, a kol., 2009, Raskin, a kol., 1997, Wang, a kol., 2012). V případě pouţití tohoto způsobu musí však být realizováno opatření, které by zamezilo nekontrolovanému rozptylu plynných zplodin. Vedle výběru rostlin a klasických šlechtitelských metod jsou genové manipulace technikou, která můţe výrazně přispět k lepšímu vyuţití rostlin pro fytoremediační účely (Jabeen, a kol., 2009). V některých případech je fytovolatizace kontroverzní, neboť nedochází k odstranění kontaminace, ale pouze k přesunu kontaminantu z půdy do ovzduší. Při fytoextrakci rostliny absorbují těţké kovy z půdy, transportují je do nadzemních částí, které se následně sklidí, čímţ se docílí odstranění daného polutantu ze zamořeného prostředí Obrázek 6 (Chuang, a kol., 2009, Clemens, 2006, Huang, a kol., 2009).

39

Obrázek 6: Různé strategie remediace vyuţívané pro dekontaminaci půd jako je fytostabilizace, fytoextrakce a fytovolatilizace. Obrázek upraven podle (Marques, a kol., 2009)

3.5.3 Glutation a fytochelatiny Glutation (GSH) je tri-peptid sloţený z aminokyselin kyseliny glutamové, cysteinu a glycinu,

patřící

mezi

nejhojnější

nízkomolekulární

tiolové

látky

ve

všech

eukaryotických organismech (Dixon, a kol., 1998, Dubreuil-Maurizi, a kol., 2011, Foyer, a kol., 1997, Foyer a Noctor, 2011). V rostlinách se podílí GSH na celé řadě buněčných procesů, včetně ochrany proti ROS a těţkým kovům a umoţňuje detoxifikaci cizorodých látek (Seth, a kol., 2012). Dále má GHS důleţitou roli v regulaci buněčného dělení a vývojových procesů např. květu. GHS je také důleţitý v transportu a ukládání redukované síry a jako signální molekula (Foyer, a kol., 2001). Syntéza GSH probíhá pomocí dvou ATP-dependentních reakcí. γ-glutamylcystein

40

syntetáza (GSH1, EC 6.3.2.2) katalyzuje vytvoření peptidové vazby mezi karboxylovou skupinou kyseliny glutamové a aminoskupinu cysteinu za vzniku γ-glutamylcysteinu (γEC). Ve druhé reakci, glutation syntetáza (GSH2, EC 6.3.2.3) liguje zbytek glycinu s γEC za vzniku GSH. Oba enzymy, GSH1 a GHS2 se vyskytují u Arabidopsis thaliana a Brassica juncea v plastidech, s tím, ţe GHS2 byla stanovena i v cytosolu (Anjum, a kol., 2012, Liu, a kol., 2012, May, a kol., 1998, Ohkama-Ohtsu, a kol., 2009, Szalai, a kol., 2009, Yadav, 2010). Glutation existuje ve dvou podobách redukovaný glutation (GSH) a oxidovaný glutation (GSSG) (Szalai, a kol., 2009). Redukční potenciál glutationu závisí na poměru intracelulárního GSH/GSSG. Změnu redoxního poměru glutationu závisí hlavně na pH, celkové koncentraci biosyntéza a katabolismus GSH (Yadav, 2010). Glutationy jsou základními jednotkami tvořící komplexnější struktury, jeţ se nazývají fytochelatiny Obrázek 7.

41

Obrázek 7: Syntéza a degradace glutationu v rostlinách. Glutation (GluT) je syntetizován v cytosolu

a chloroplastech pomocí gama-glutamylcystein syntetázy

g(ECS) kódované genem GSH1 a glutation syntetázy (GSH-S) kódované genem GSH. Jako antioxydant se glutation oxiduje na GSSG. Díky působení glutation reduktázy (GSH-R) kódované genem (GSR) se GluT vyskytuje především v jeho redukované formě (GSH) a to především v cytosolu, mitochondriích a chloroplastech. GluT má schopnost detoxifikovat xenobobiotika a to díky glutation-S-transferázy (GST), která zajišťuje vazbu mezi Glu a xenobiotikem za vzniku konjugátu GS-X. GST je kódována velkým mnoţstvím GST genů, které mohou exprimovat i Cd ionty nebo H2O2. Glutation je také substrátem pro enzym fytochelatin syntetázy (PCS), která umoţňuje tvorbu fytochelatinů. Degradace GluT se uskutečňuje pomocí gama-glutamyl transpeptidázy (GGT) kódovaná geny GGT1-4. Hydrolýza GluT na kyselinu glutamovou (Glu) a dipeptid

cysteinylglycin (Cys-Gly). Degradace GluT přes

aminokyselinový nebo peptidový receptor (aa-pp) za vzniku gama-glutamylové aminokyseliny a dipetidu Cys-Gly. Obrázek upraven podle (Foyer, a kol., 2001)

3.5.3.1 Geny zapojené do syntézy glutationu Syntézu GSH umoţňují dva enzymy, gama-glutamylcystein syntetáza (γECS) a glutation syntetáza (GSH-S) Oba enzymy jsou kódovány jedním genem. Gen pro γ(ECS) je nazýván GSH1 a gen pro GSH-S se označuje jako GSH2 (Ohkama-Ohtsu, a kol., 2009, Schutzendubel a Polle, 2002, Seth, a kol., 2012). Vyřazením jednoho z genů u A. thaliana mělo letální následky a to u genu GSH1 uţ v embryonální fázi, zatímco u genu GSH2 při vývoji semenáčků (Liu, a kol., 2012). Oba geny jsou přednostně aktivovány kyselinou jasmonovou (JA) a těţkými kovy (Xiang a Oliver, 1998). Dalšími aktivátory jsou světlo, sucho a patogeny. Zajímavé je to s H2O2, který zvyšuje hladinu GSH v buňce i přesto, ţe nemá vliv na hladinu GSH1 a GSH2 transkriptů (DubreuilMaurizi, a kol., 2011, Szalai, a kol., 2009). To vedlo k tomu, ţe syntéza γ(ECS) proteinu je hlavně ovlivněna posttranslačně (Hasan, a kol., 2009). Nicméně mnohem více pozornosti je věnováno posttranskripčním úpravám. Syntézu glutationu ovlivňují i geny respektive transkripty zapojené do syntézy cysteinu a asimilace síry. Při oxidativním stresu roste hladina GSH, která způsobuje akumulaci transkriptů kódující

42

adenosin-5'-fosfosulfát reduktázu (APR) a serin acetyltransferázu (SAT). U A. thaliana existují 3 geny pro APR a všechny kódují enzymy vyskytující se v plastidech (Foyer, a kol., 2009, Queval, a kol., 2009). Pouze jediný gen pro SAT produkuje isoformu enzymu v této organele. Nejvíce cysteinu zajišťuje, za standardních podmínek, SAT v mitochondriích (Kawashima, a kol., 2011). Při působení peroxidu vodíku spouštějící akumulaci glutationu, dochází k největší indukci SAT v chloroplastech (Queval, a kol., 2009).

3.5.3.2 Geny zapojené do transportu glutationu Koncentraci glutationu v různých buňkách a pletivech udrţuje systém rovnováhy mezi syntézou, degradací, jeho vyuţitím a transportem na krátké a dlouhé vzdálenosti. Glutation můţe být transportován jak do buňky, tak i z buňky ven. Na příjmu glutationu u A. thaliana, rýţe a bavlny se podílí devět homologních genů Hgt1. Nejvíce je prostudován transport glutationu a konjugátů glutationu (GS-X) mezi vakuolou a cytosolem. Tohoto transportu se účastní ABC proteiny ze subrodiny MRPs (z ang. multidrug-resistance-associated proteins) Mg-ATP (Smital, a kol., 2006). Geny pro MRPs transportní proteiny byly objeveny mimo A. thaliana i u sóji, rajčat, rýţe, pšenice a kukuřice, coţ naznačuje, ţe se budou pravděpodobně vyskytovat u všech vyšších rostlin (Foyer, a kol., 2001). 3.5.3.3 Geny zapojené do degradace glutationu Degradace glutationu probíhá za účasti enzymu γ-glutamyl transpeptidáza (GGT), která v apoplastu degraduje oxidovanou formu glutationu (GSSG) a ve vakuole pak redukovanou formu glutationu (GSH) (Noctor, a kol., 2012, Szalai, a kol., 2009). GGT katalyzuje přenos γ-glutamové skupiny z GSH na receptory, kterými je buď voda, nebo aminokyseliny (Ohkama-Ohtsu, a kol., 2009). Pokud je příjemcem voda γ-glutamová vazba je hydrolyzována na kyselinu glutamovou (Glu) a dipeptid cysteinylglycin (CysGly) (Ohkama-Ohtsu, a kol., 2009). V případě aminokyseliny nebo nějakého peptidu dochází

ke

vzniku

gama-glutamylové

aminokyseliny

nebo

nějakého

gama

glutamylového peptidu a dipetidu Cys-Gly. γ-glutamyl transpeptidáza je kódována čtyřmi geny GGT1 (AT4g39640), GGT2 (At4g39650), GGT3 (AT1g69820), a GGT4

43

(AT4g29210) (Destro, a kol., 2011, Ohkama-Ohtsu, a kol., 2008, Ohkama-Ohtsu, a kol., 2007, Ohkama-Ohtsu, a kol., 2007). Experimenty s GGT1: GUS (β-glucuronidase) transgenními rostlinami, které exprimovaly GUS reportérový gen kontrolovaný GGT1 promotorem, ukázaly, ţe GGT1 byl exprimován ve vaskulárním pletivu a to ve floému, ţilnatině listů, v kořenech a květech. Lokalizace byla provedena pomocí laserové mikrodisekce, která ukázala, ţe ve vaskulárních pletivech se nachází aţ 17 krát vyšší mnoţství GGT1 mRNA, neţ v pletivech mezofilních. Pokud se naruší syntéza glutationu, dojde za méně jak jeden den ke sníţení jeho hladiny v buňkách aţ o 80% (Destro, a kol., 2011, Ohkama-Ohtsu, a kol., 2008, Ohkama-Ohtsu, a kol., 2007, Ohkama-Ohtsu, a kol., 2007). Nejdůleţitější funkcí glutationu je jeho úloha jako prekurzoru v biosyntéze fytochelatinů (PCs), patřící mezi hlavní látky účastnící se ochrany a odpovědi rostlin proti těţkým kovům (Cobbett a Goldsbrough, 2002, Grill, a kol., 1989). PCs byly objeveny u jednoděloţných, dvouděloţných i nahosemenných rostlin, řas a hub. U ţivočichů PCs nebyly zatím potvrzeny. Fytochelatiny se skládají z opakujících se jednotek (2 aţ 11 krát) gama glutamové kyseliny a cysteinu (γ-GluCys) a koncové aminokyseliny glycinu (Gly), který můţe být nahrazen jinou aminokyselinou (Ala, Glu, Ser) (Chaffai a Koyama, 2011, Grill, a kol., 1987, Hirata, a kol., 2005). Ze struktury jasně vyplývá, ţe jsou syntetizovány enzymatickou cestou z GSH nebo jeho homologů pomocí enzymu fytochelatin syntetázy (PCS) nejčastěji za přítomnosti těţkých kovů (Ha, a kol., 1999). 3.5.3.4 Detoxifikace těžkých kovů fytochelatiny Primárním mechanismem detoxifikace těţkých kovů je jejich chelatace pomocí PCs a rovněţ za účasti antioxidačního systému zastoupeného enzymy jako je superoxidismutáza, Guajakol peroxidáza, askorbát peroxidáza či glutation reduktáza, bránící rostlinu před volnými radikály vznikající působením těţkých kovů (Cobbett a Goldsbrough, 2002, Pal a Rai, 2010). PCs interagují s těţkými kovy prostřednictvím tiolových skupin (-SH), které má ve své struktuře cystein (Pal a Rai, 2010). Stupeň polymerace v PCs roste s koncentrací intracelulárního kovu indukujícího zvýšení vazebné stability celého PCs-kov komplexu (Padmavathiamma a Li, 2007). Vytvoření komplexu PCs-kov souvisí s dostupností ligandů, kinetice vznikajícího komplexu a sterickém faktoru. Strukturní model komplexu PC-Cd ukazuje, ţe vazebná

44

stechiometrie atomů síry můţe být buď z jedné nebo více molekul fytochelatinu (4 aţ 1), a vytváří tak amorfní komplexy (Obrázek 8) (Cobbett, 2000). Komplex kov-PCs se označuje jako nízko molekulární komplex (low molecular weight – LMW). Tento komplex je transportován do vakuoly za účasti transportéru HMT1, (heavy metal tolerance factor 1), patřící do velké rodiny transportních proteinů ABC (Ortiz, a kol., 1992, Ortiz, a kol., 1995). Po vstupu do vakuoly je LMW komplex transformován na vysoko molekulární komplex HMW (high molecular weight) pomocí vazby přes –S-Sskupiny (Najmanova, a kol., 2012, Supalkova, a kol., 2007). Ranieri uvádí, ţe stres generovaný částečnou akumulací Cd v listech Triticum aestivum byl potlačován antioxidační odpovědí a biosyntézou PCs (Ranieri, a kol., 2005). Pokud však dojde k akumulaci nadměrného mnoţství Cd iontů, vzroste prudce koncentrace H2O2 i přes zvýšené mnoţství dostupných PCs a ostatních tiolových látek (Ranieri, a kol., 2005). Existují ekotypy, které jsou tolerantní k těţkým kovům i přestoţe syntetizují méně PCs neţ ekotypy senzitivní. Rostlina Sedum alfredii u níţ bylo pozorováno, ţe pokud rostla ve starém dole, kde byla půda kontaminována vysokou koncentrací olova a zinku, měla vysokou míru tolerance na tyto kovy, oproti stejným druhům rostoucích mimo tyto oblasti (Pal a Rai, 2010).

45

Obrázek 8: Interakce PCs s kademnatými ionty. PCs váţí Cd2+ pomocí –SH skupin z aminokyseliny cysteinu. Cd+2 mohou vytvářet s –SH skupinami různé komplexy. Obrázek upraven podle (Pal a Rai, 2010) Mutantní rostliny Arabidopsis thaliana, které měly narušenou syntézu PCs jasně prokázaly významnou roli PCs v detoxifikaci těţkých kovů. Mutant (cad1), který nemá gen pro PC syntetázu, izolovaný z EMS-mutagenních (mutagenní látka - Ethyl methanesulfonate) rostlin F2 populace, byl hypersenzitivní k iontům Cd (Cazale a Clemens, 2001, Howden a Cobbett, 1992, Howden, a kol., 1995, Lee, a kol., 2003). Tento mutant není schopen růst v přítomnosti 30 mM Cd oproti WT rodičům, coţ způsobuje recesivní mutace genu souvisejícího se syntézou

PCs. Těţké kovy tak

významně ovlivňují syntézu tiolových sloučenin (Babula, a kol., 2008, Hasan, a kol., 2009, Rai, 2008, Shah a Nongkynrih, 2007).

3.5.4 Reaktivní formy kyslíku Reaktivní formy kyslíku (ROS – z ang. Reactive oxygen species) jsou v malém mnoţství produkovány běţným metabolismem buněk (Karuppanapandian, a kol., 2011). Nicméně za stresových podmínek vyvolaných především abiotickými stresovými faktory, dochází k disbalanci mezi vytvářením ROS a jejich únosnou mírou (Kreslavski, a kol., 2012, Ray, a kol., 2012). Nadměrná tvorba ROS způsobuje pak inaktivaci enzymů, poškození jednotlivých organel degradací pigmentů a biomembrán, poškození proteinů, lipidů a především nukleových kyselin (Apel a Hirt, 2004, Thannickal a Fanburg, 2000). Všechny tyto děje pak způsobují smrt buňky a celého organismu. Mezi nebezpečné ROS patří singletový kyslík (1O2); superoxidový anionradikál (O2∙ −); hydroxylový radikál (OH∙); hydroxylový ion (OH−); perhydroxylový radikál (O2H∙); peroxid vodíku (H2O2). Těţké kovy patří mezi významné faktory produkující ROS především (O2˙ˉ, H2O2 and OH˙) (Apel a Hirt, 2004, Liu, a kol., 2004, Mittler, a kol., 2004, Piterkova, a kol., 2005, Thannickal a Fanburg, 2000). Jeden z nejvíce škodlivých účinků vyvolaných expozicí těţkých kovů v rostlinách je oxidační degradace lipidů (peroxidace lipidů), čímţ dochází k degradaci biomembrán (Mittler, 2002, Overmyer, a kol., 2003). Obrázek 9 a 10 ukazuje vznik a reaktivitu ROS s dalšími molekulami v rostlinné buňce. Zdroje reaktivních forem kyslíku (ROS) v rostlinných buňkách a jejich reaktivitu v různých kompártmentech buňky popisuje následující text.

46

V chloroplastech je příjem molekulárního kyslíku (O2) spojen s fotoredukcí superoxidový anionradikál (O2∙ −) (Lagriffoul, a kol., 1998, Liu, a kol., 2004, Mullineaux a Rausch, 2005, Noctor, a kol., 1998). Singletový kyslík (1O2) je produkován při přenosu energie na triplexový kyslík (3O2) z excitovaného chlorofylu ve fotosystému II (PSII). Excitace PSII vede k oxidaci H2O na O2. Reduktanty vytváří pomocí těchto procesů donory elektronů (e-) pro plastochinon (PQ), který je přenáší na cytochromový komplex f (Cyt f). Tento komplex přenáší elektrony na malý protein plastocyanin (PC), který přenáší elektrony dál k fotosystému I (PSI). PSI s elektrochemickým negativním potenciálem předávají e- na O2 za vzniku superoxidového anionradikálu (O2∙ −) (Apel a Hirt, 2004, Foyer, a kol., 2009, Lagriffoul, a kol., 1998, Liu, a kol., 2004, Mullineaux a Rausch, 2005, Noctor, a kol., 1998, Rouhier, a kol., 2008). Většina (O2˙ˉ) in vivo je produkováno prostřednictvím přenosu elektronů ferredoxinem (FD) na O2. Vytvořený (O2˙ˉ) pak podléhá dismutaci (spontánně nebo za účasti superoxiddismutásy), čímţ vzniká peroxid vodíku (H2O2). V přítomnosti přechodných kovů jako je ţelezo mohou z O2˙ˉ a H2O2 vznikat hydroxylové radikály (OH˙). H2O2 také vznikají při fotorespiraci, kdy dochází k oxidaci glykolátu v peroxizomech. K produkci O2˙ˉ také dochází při oxidaci xantinu a hypoxanthinu na kyselinu močovou (Mullineaux a Rausch, 2005, Rouhier, a kol., 2008). V mitochondriích dochází k přímé redukci (O2 na O2∙ −), která se děje ve flavinové jednotce enzymového komplexu NADH dehydrogenázy. Během tohoto elektron- transportního řetězce je koncentrace O2∙

−

výrazně zvýšena pokud je

přítomen antimycin A, který inhibuje tok elektronů z cytochromu b na cytochrom c1 (Kreslavski, a kol., 2012, Noctor, a kol., 2012, Queval, a kol., 2009, Zaffagnini, a kol., 2012). Producentem peroxidu vodíku je i acylkoenzym A-oxidáza (acyl-CoA), klíčový enzym beta oxidace mastných kyselin. Mezi hlavní producenty O2∙− a H2O2 v apoplastu jsou enzymy NADH oxidáza přítomná v cytoplazmatické membráně a extracelulární enzymy jako jsou peroxidázy a oxidázy v buněčné stěně. Peroxidázy jsou v buněčné stěně aktivovány alkalickým pH, které v přítomnosti reduktantů vytváří právě H2O2 (Foyer, a kol., 1997, Karpinski, a kol., 1997, Lamb a Dixon, 1997, Neill, a kol., 2002, Pellinen, a kol., 1999, Thannickal a Fanburg, 2000). Obrázek 9 ukazuje vliv Cd iontů na produkci ROS a Obrázek 10 popisuje přirozenou tvorbu ROS.

47

Obrázek 9: Hypotetický model produkce ROS v listech a jejich úloha při dlouhodobé expozici Cd ionty na rostliny. Kademnaté ionty způsobují v různých částech buňky zvýšenou produkci ROS, které způsobují lignifikaci buněčné stěny a oxidativní procesy způsobující poškození lipidů a proteinů. ROS i přes jejich negativní vlivy mohou společně s kyselinou jasmínovou JA a kyselinou salicylovou (SA) slouţit jako signální molekuly přímo regulující obranou reakci proti Cd iontům. Červené šipky znázorňují redukci tvorby a modré aktivaci jednotlivých molekul. Zkratky: CAM – kalmodulin; cGMP - guanosin -5´ mono-fosfát; HSP - proteiny tepelného šoku (z ang. Heat shock proteins); JA - kyselina jasmonová; C2H4 – etylen; NOS -syntáza oxidu dusnatého z ang. nitric oxide synthese. Upraveno podle (Mittler, a kol., 2004).

48

Obrázek 10: Schéma ukazující hlavní přirozené zdroje vzniku ROS.

49

Obrázek 10. Lokalizace reaktivních forem kyslíku (ROS) a metabolických drah, při kterých vznikají, transformují, zanikají či detoxifikují ROS. Na obrázku vidíme část buňky. Vodní cyklus detoxifikuje - a H2O2, případně oxidázy (OAX) sniţují rychlost tvorby O2 v tylakoidech. V chloroplastech některých rostlin můţe Fe-superoxid dismutáza (FeSOD) nahradit CuZnSOD (obrázek vlevo nahoře). ROS, které se tomuto cyklu vyhnou anebo jsou produkovány ve stromatu, se detoxifikují pomocí SOD a cyklem kyseliny askorbové a glutationu. Peroxiredoxin (PrxR) a glutation peroxidáza (GPX) jsou také zapojeny do odstranění H2O2 ve stromatu (obrázek vpravo nahoře). ROS produkované v peroxizomech během fotorespirace, oxidace tuků nebo při dalších reakcích jsou rozloţeny pomocí SOD, katalázy (CAT) a askorbát peroxidázy (APX) (obrázek uprostřed nahoře). SOD, OAX a další komponenty zapojené do askorbátglutathion cyklu se nacházejí i v mitochondriích (obrázek vpravo dole). Obecně platí, ţe cytosol obsahuje stejné typy enzymů, které jsou ve stromatu, avšak nejsou kódovány stejnou skupinou genů (obrázek vlevo dole). Doposud není zcela jasné, jakým principem dochází k zamezení tvorbě hydroxylového radikálu (OH∙). Stejně tak je ne zcela dobře popsána detoxifikace ROS v apoplastu, buněčné stěně a vakuole. Ve stromatu a cytosolu znázorňují pole s bílým pozadím membránové enzymy, přerušované šipky metabolické dráhy GPX a tečkované šipky PrxR. Přestoţe jednotlivé metabolické dráhy probíhají v různých kompártmentech dochází u H2O2 volné difúzi přes membrány jednotlivých organel nebo k transportu jako je to u glutationu a kyseliny askorbové, jsou naopak transportovány. Další zkratky: DHA - dehydroaskorbát; DHAR - DHA reduktáza; FD - ferredoxin; FNR - ferredoxin NADPH reduktáza; GLR – glutaredoxin; GR - glutation reduktáza; GSSG - oxidovaný glutation; GSH redukovaný glutation; MDA - monodehydroaskorbát, MDAR - MDA reduktáza, PSI fotosystém I; PSII - fotosystém II; TRX – thioredoxin; Tyl – tylakoid Upraveno podle (Mittler, a kol., 2004).

50

3.6 Metody pro posouzení míry stresu u rostlin Porozumění mechanizmu průběhu stresové reakce u rostlin ať na biotické či biotické stresové faktory, nám umožňují metody, postupy, analýzy založené na sledování molekul zapojených do stresové reakce. Můžeme sledovat nukleové kyseliny, proteiny, nebo vlastní stresové činitele a na základě porovnání dat z ovlivněných a kontrolních pokusných rostlin pak stanovit jakou roli v těchto procesech hrají oné molekuly (Galiova, a kol., 2008, Jiang, a kol., 2008, Kassahn, 2008). Analýza těchto látek nám poskytuje i informace o vhodnosti daného druhu rostliny pro využití k fytoremediačním účelům. V současnosti je snaha hledat takzvané hyperakumulující rostliny, které jsou schopny vysoce tolerovat ale i akumulovat těžké kovy (Krystofova, a kol., 2012, Rascio a Navari-Izzo, 2011, Shestivska, a kol., 2011). K tomu abychom hyperakumulující rostliny mohli hledat, ale hlavně posoudit z hlediska jejich vhodnosti, musíme mít k dispozici

metody

analyzující

rostlinu

na

třech

základních

„omikách“:

i)

transkriptomiky, ii) proteomiky a iii) metabolomiky (Kiechle a Holland-Staley, 2003, Roelofs, a kol., 2008). 3.6.1 Transkriptomika a genomika Jak bylo ukázáno v předchozích kapitolách, aklimatizace rostlin na měnící se podmínky prostředí vyžaduje řadu biochemických, fyziologických a molekulární změn (Mittler, 2006). Tyto změny jsou prováděny prostřednictvím exprese řady genů pro transkripční fakrory, F-box proteiny, transportéry, ATP sulfurylázu, PC syntetázu, UBC proteiny (Chen, a kol., 2002, Harada, a kol., 2002, Kawashima, a kol., 2011, Pal a Rai, 2010, Parry, a kol., 2009). Hladina transkriptomu, jak je nazýván soubor všech mRNA v dané buňce, orgánu či organizmu se dramaticky, v závislosti na podmínkách, neustále mění (Huska, a kol., 2010, Huska, a kol., 2009, Huska, a kol., 2007). Geny účastnící se těchto procesů jsou zahrnovány do dvou skupin. Geny regulující samotnou genovou expresi genů zahrnutých do druhé skupiny, účastnící se již samotné reakce na stresové podmínky (Ha, a kol., 1999, Hall, 2002, Hanikenne, a kol., 2008, Heiss, a kol., 2003, Kim, a kol., 2007, Lee, a kol., 2003). První skupina genů kóduje regulační proteiny (kinásy, fosfatázy, transkripční faktory a RNA vázající proteiny. Do druhé skupiny spadají geny exprimující proteiny zapojené přímo v ochraně, jako jsou detoxifikační

51

enzymy,

enzymy potřebné

pro

biosyntézu osmoprotektantů,

vodních

kanálků,

nemrznoucí bílkoviny (AFP), chaperony a LEA proteiny hrající roly v pozdní embryogenezi (Bernard, a kol., 2004, Bies-Etheve, a kol., 2008, Chiang, a kol., 2006). Další významnou skupinu genů jsou geny kódující trans-membránové proteiny a přenašeče signálů. Přenos signálu v sobě zahrnuje sloţité interakce genů, ve kterých hrají důleţitou roli transkripční faktory. Regulace jejich exprese výrazně ovlivňuje odpověď rostliny na stresové faktory. Zavedením technologie transkriptomiky a genomiky se podařilo identifikovat řadu genů, zapojených právě do odpovědi na Cd2+ (Alba, a kol., 2004, Chuang, a kol., 2009, Gardiner, a kol., 2010, Herbette, a kol., 2006, Huska, a kol., 2009, Li, a kol., 2010). Při těchto experimentech byly vyuţívány zejména technologie DNA array (DalCorso, a kol., 2008). Microarrays umoţnily rychlý rozvoj analýzy genové exprese. Metoda je zaloţena na extrakci celkové mRNA (transkriptomu), která je následovně reverzní transkripcí převedena na cDNA. Pro zajištění většího mnoţství jednotlivých cDNA se někdy provádí i PCR reakce. Poté jsou cDNA označeny označena fluorescenčními nebo i radioaktivní značkou, které později umoţní detekovat signál. Na závěr jsou vzorky denaturovány a vznikne tak směs jednovláknových cDNA. Tyto cDNA jsou aplikovány na čip, který obsahuje tisíce aţ milióny DNA oligonuleotidů reprezentující specifické části genů. Po hybridizaci cDNA s DNA oligonukleotidy se čip promyje a nenavázané či jen slabě navázané cDNA se tím odstraní (Alba, a kol., 2004, Ding, a kol., 2011, Kassahn, 2008, Lee a Tranel, 2008, Pariset, a kol., 2009, Seki, a kol., 2001, Suwabe a Yano, 2008, Uttamchandani, a kol., 2009). Stále problematické je vyhodnocení čipu (Kassahn, 2008, Pariset, a kol., 2009, Sunkar, 2010). Vyhodnocení probíhá pomocí vysoce senzitivních zařízení schopné detekovat jednotlivé značky. Ještě problematičtější je pak vyhodnocení dat a to vzhledem na jejich obrovské mnoţství. Nicméně pomocí této technologie bylo moţno odhalit mnoho genů a jejich funkce (Alba, a kol., 2004). Modifikací microarray je tzv. dvoukanálový experiment. Zde se vyuţívá dvou značek, přičemţ jedna pochází od vzorku kontrolního a druhá od vzorku, jenţ má mutaci, či je nějakým způsobem ovlivňován. Výsledkem takového experimentu je informace o expresi genů z obou vzorů a jednotlivé rozdíly v expresi se porovnávají (Alba, a kol., 2004, Pariset, a kol., 2009). Analýza je standardní technikou pro analýzu exprese genů u organismů se známou genetickou informací (Kassahn, 2008). U organizmů kde genomická data chybí nebo jich není mnoho se klasické microarray aplikují obtíţně, protoţe zde můţeme

52

analyzovat jen známé geny (Pariset, a kol., 2009). Další technika umoţňující analýzu transkriptomu se nazývá sériová analýza genové exprese (SAGE) (Kido, a kol., 2011). Tato metoda je vhodná pro studium exprese s omezenými genomickými informacemi o daném organizmu (Yamaguchi, a kol., 2010). Pomocí metody SAGE lze získaná data i kvantifikovat. SAGE je zaloţena na štěpení krátkých specifických úseků 10 – 20 nukleotidů z cDNA (tagy) pomocí restrikčních enzymů. Jednotlivé vyštípané tagy jsou pak ligovány do dlouhých DNA a sekvencovány (Mardis, 2008, Yamaguchi, a kol., 2010). Získaná data se počítačově analyzují, přičemţ jsou určeny a roztřízeny jednotlivé tagy. Získává se tím soubor dat, knihovna, která slouţí k porovnání získaných dat z jiných laboratoří. Pro identifikaci jednotlivých tagů je obvykle vyuţívána databáze SAGEmap. Ta přiřazuje jednotlivé tagy podle jejich sekvence k transkriptům definovaným v databázi UniGene (Pariset, a kol., 2009). 3.6.2 Paramagnetické částice Společné však pro všechny uvedené metody je nutnost izolace nukleových kyselin (Haun, a kol., 2010, Huska, a kol., 2009, Kim, a kol., 2003, Mardis, 2008, Papoyan a Kochian, 2004, Rosi a Mirkin, 2005, Shen, a kol., 2012, Waschke, a kol., 2006). Vedle klasických a stále nejčastěji pouţívaných metod izolace nukleových kyselin (NK) jako je fenol chloroformová extrakce a systém nejrůznějších kitů, jejichţ principem je nejtypičtěji jemný filtr zachycující silikátové částice a nukleové kyseliny, kdy postupnými kroky se promýváním získá daná nukleová kyselina, existují i metody, zaloţené na superamagnetických nebo paramagnetických částicích (MPs) (Akbarzadeh, a kol., 2012, Huska, a kol., 2009, Koh a Josephson, 2009, Zhao, a kol., 2011). Izolace NK pomocí MPs je zaloţena na i) interakci mezi NK a MPs, kdy cílová skupina nukleových kyselin interaguje s molekulami navázanými na povrch MPs a ii) interakci mezi MPs a vnějším magnetickým polem, kdy MPs s navázanou cílovou NK jsou zachyceny vnějším magnetickým polem ke stěně zkumavky, čímţ mohou být z lyzátu odstraněny interferující

látky.

Povrch

MPs

lze

modifikovat

podle

potřeby

oligonukleotidy specifickými (pro izolaci zcela konkrétních nukleových kyselin) nebo univerzálními (pro izolaci větší skupiny nukleových kyselin, jako je transkriptom celkové mnoţství mRNA či genomová DNA) (Huska, a kol., 2009, Huska, a kol., 2010,

53

Huska, a kol., 2009, Huska, a kol., 2009, Huska, a kol., 2007, Huska, a kol., 2009, Supalkova, a kol., 2007). Do technik vyuţívající paramagnetické částice výrazným způsobem zasáhly nanotechnologie a elektrochemické techniky, které jejich moţnosti vyuţití značně rozšířily a to zejména v diagnostice biomolekul a nukleových kyselin (Akbarzadeh, a kol., 2012, Bard, a kol., 2010, Diculescu, a kol., 2005, Drummond, a kol., 2003, Geimer, a kol., 2009, Haun, a kol., 2010, Palecek, 2009, Vacek, a kol., 2011, Zhao, a kol., 2011). S pojením elektrochemických technik s paramagnetickými částicemi získáváme unikátní nástroj pro studium nejen nukleových kyselin a proteinů, ale i pro analýzu interakcí s ostatními látkami (Diculescu, a kol., 2005, Drummond, a kol., 2003, Vacek, a kol., 2011). Historie elektrochemie nukleových kyselin spadá do roku 1958, kdy profesor Emil Paleček publikoval první práci poukazující na elektro-aktivitu nukleových kyselin (Palecek, 2009). V roce 1961 byla publikována práce zabývající se adsorpcí DNA na povrch rtuťové elektrody, kdy dochází k redukci cytosinu a adeninu, přičemţ na výsledném signálu pozorujeme pouze jediný takzvaný CA pík a to při potenciálech kolem –1,45 V. Guanin či tymin se na rtuťové elektrodě redukují při vysokých potenciálech a jejich signály nejsme schopni pozorovat (Diculescu, a kol., 2005, Palecek, 2009, Vacek, a kol., 2011). Všechny báze však poskytují oxidační signály na pevných elektrodách v pořadí potenciálu (+1,0 V) guaninu; (+1,2 V) adeninu a (+1,2 aţ +1,3 V) cytosinu a tyminu (Prasek, a kol., 2011). Od této doby bylo v elektrochemii nukleových kyselin značně pokročeno dál. V současnosti jsou elektrochemické

techniky

vyhledávanými

metodami

díky

jejich

citlivosti,

ekonomičnosti, ale především v moţnosti je propojovat a automatizovat s jinými metodami a v neposlední řadě je miniaturizovat aţ do nanometrických rozměrů. (Bard, a kol., 2010, de-los-Santos-Alvarez, a kol., 2004, Diculescu, a kol., 2005, Drummond, a kol., 2003, Haun, a kol., 2010, Li, a kol., 2009). 3.6.2.1 Nanotechnologie Nanotechnologie, nanoelektronika

nanosvět,

nanooptika,

nanomateriály,

nanovýroba,

nanočástice,

nanobiotechnologie,

nanochemie, nanoanalytika,

nanomedicína všechny tyto pojmy dnes zahrnují vědecký svět. Vidíme je všude kolem nás. Nanotechnologie se dnes řadí mezi první pozice v pomyslné příčce – co dnešní

54

věda nejintenzivněji studie a aplikuje. Nanotechnologie jsou ale především studovány a aplikovány v ţivočišné říši. Rostlinná říše, jak uţ tomu bývá, i přes její nevyvratitelnou důleţitost, je opomíjena. Ovšem i zde se začínají uplatňovat nejrůznější metody, postupy, materiály a přístroje vyuţívající nanotechnologie. I v rostlinné říši si nanotechnologie našla místo (Berry a Curtis, 2003, Sarikaya, a kol., 2003). Termín nanotechnologie nemá doposud danou definici, ovšem obecně lze říci, ţe nanotechnologie je výzkum a technologický vývoj na atomové, molekulární nebo makromolekulární úrovni, v rozměrové škále přibliţně 1—100 nm (Berry a Curtis, 2003, Chomoucka, a kol., 2010, Dai, 2002, Sarikaya, a kol., 2003). Je to téţ vytváření a pouţívání struktur, zařízení a systémů, které mají v důsledku svých malých nebo intermediárních rozměrů nové vlastnosti a funkce (Chomoucka, a kol., 2010). Dále je to dovednost manipulovat s objekty na atomové úrovni. První doposud známé nanomateriály přišly na svět, ačkoliv je pravděpodobné, ţe tehdejší výrobci o tom neměli zdání, asi ve 4. století našeho letopočtu. Z této doby byly objeveny tzv. Lykurgovy poháry (Freestone, a kol., 2007, Kuno, 2012). Jak se ukázalo, pro dosaţení barevných efektů, pouţívali tehdejší skláři prášky z kovů jako je zlato, stříbro, zinek, kadmium, síra, selen a mezi těmito prášky se našly i částice v rozměru nanometrů. První vědecké články spojující nanotechnologii a rostliny vznikají aţ na počátku 21. století a dodnes se především zaměřují na vyuţití nanočástic (Daniel a Astruc, 2004, Seeman, 2003). Propojení nanotechnologie a rostliny se děje na úrovni vyuţívání nanočástic pro izolace biologicky aktivních molekul jako jsou především DNA a RNA a dále proteinů, ale napomáhají i při charakterizaci těchto molekul a při objasňování jejich funkce (Cao, a kol., 2002, Huska, a kol., 2009, Huska, a kol., 2009, Neuberger, a kol., 2005). V této oblasti výzkumu se vyuţívají především bionanosenzory (Haun, a kol., 2010, Koh a Josephson, 2009, Lee a Tranel, 2008). Výzkum se dále soustředí na konstrukci zařízení na bázi nanotechnologie, které pomohou lépe pochopit fungování rostlinného organismu. Hlavně se to spatřuje v genetickém inţenýrství k vytváření nových odrůd odolnějším k biotickým a abiotickým faktorům a k tvorbě výnosově lepším odrůdám plodin. Dále jsou vkládány velké naděje do oblasti výzkumu rostlinných vakcín (Khot, a kol., 2012, Luders, a kol., 2012, Martin-Ortigosa, a kol., 2012, Rai a Ingle, 2012).

55

3.6.3 Elektrochemické bionanosenzory Metody pro studium nukleových kyselin a jejich identifikaci vyţadují velmi senzitivní analytické nástroje. Microarry, pokud se nejedná o elektrochemický, pouţívají pro tyto účely především fluorescenční sondy, ty jsou však limitovány citlivostí a náročností na vyhodnocení získaných dat (Hadidi, a kol., 2004, Park, a kol., 2002). Rozhodující sloţkou DNA, RNA biosenzorů se tedy stává metoda jejich detekce a izolace (Wang, 2003). Elektrochemické bionanosenzory (EBiNS) významným způsobem zasahují do detekce nukleových kyselin (Huska, a kol., 2010, Seidel a Niessner, 2008, Vacek, a kol., 2011, Yang, a kol., 2011). Vysoká citlivost EBiNS a moţnost jejich miniaturizace, kompatibilitu s moderními technologiemi, nízkou cenou, nízkými nároky na napájení (moţnost vyuţití in-situ) jsou vynikajícími kandidáty na studium nukleových kyselin (Cai, a kol., 2002, Drummond, a kol., 2003, Park, a kol., 2002, Ramsay, 1998). 3.6.3.1 Nanočástice a Elektrochemické bionanosenzory Mezi nejčastěji pouţívané nanočástice v EBiNS patří zlaté, stříbrné, ţelezné (Wang, a kol., 2001). Díky jejich velkému povrchu, vysoké mechanické odolnosti, vynikající elektrické a katalytické a magnetické vlastnosti a moţnosti interagovat s širokou škálou biologických a chemických látek (Akbarzadeh, a kol., 2012, Bard, a kol., 2010, Dai, 2002, Daniel a Astruc, 2004, Haun, a kol., 2010). Zlaté nebo stříbrné nanočástice lze vyuţít pro sestrojení hybridizačního čipu s elektrochemickou detekcí (Drummond, a kol., 2003, Haun, a kol., 2010). Zde se imobilizuje DNA sonda na streptavidinem modifikované magnetické částice, následně se hybridizuje cílová sekvence. Díky tomuto uspořádání lze dosáhnout limitu detekce nukleových kyselin na piko-molární koncentraci. Limit detekce lze dál zlepšit (sub-piko-molární koncentrace) vazbou zlatých nebo stříbrných nanočástic na jiţ imobilizovanou sondu s cílovou sekvencí, čímţ se docílí znásobení výsledného signálu Obrázek 11 (Wang a Kawde, 2002, Wang, a kol., 2003, Wang, a kol., 2003).

56

Obrázek 11: Schéma postupu při detekci nukleových kyselin pomocí magnetických a zlatých částic. (Wang, a kol., 2003) Dalším moţným způsobem jak docílit hybridizačního kitu je vyuţití zlaté vrstvy, na které je imobilizovaná DNA sonda prostřednictvím –SH skupin. Po přidání vzorku se k DNA sondě nahybriduzuje cílová sekvence, jak ukazuje Obrázek 12. Po hybridizaci se ke vzorku naváţí prostřednictvím hydrochinonu stříbrné ionty, které jsou nakonec detekovány pomocí rozpouštěcí potenciometrie (Wang, 2002, Wang, 2003, Wang, a kol., 2003, Wang, a kol., 2003, Wang, a kol., 2001, Wang, a kol., 2003, Wang, a kol., 2012). Celý postup znázorňuje Obrázek 12.

57

Obrázek 12: Schematické znázornění postupu detekce nukleových kyselin pomocí stříbrných iontů a elektrochemie; a) imobilizace ssDNA sondy přes –SH a 5´-fosfátové skupiny na zlatý povrch; b) navázaní cílové sekvence na sondu – hybridizace; c) navázaní stříbrných iontů na sondu a cílovou sekvenci; d) hydrochinonem katalyzovaná redukce stříbrných iontů; rozpuštění stříbra v roztoku kyseliny dusičné a detekce pomocí elektrochemie upraveno podle (Wang, a kol., 2003)

58

3.6.3.2 Kvantové tečky Kvantové tečky (QD z ang.

quantum dots) jsou fluoreskující polovodičové

nanokrystaly o velikosti mezi 2 – 10 nm (Dubertret, 2005, Liu, a kol., 2011, Zhang, a kol., 2005). V současnosti hrají důleţitou roli v zobrazovacích technikách jako fluorescenční značky (Ryvolova, a kol., 2011). Oproti konvenčním fluoroforů mají kvantové tečky symetrická emisní spektra a jsou fotochemicky stabilní. Další velkou výhodou je schopnost detekovat více různých fluorescenčních signálů pouze jednou vlnovou délkou. Nejvíce pouţívané kvantové tečky jsou CdTe, CdSe, ZnSe a ZnS (Han, a kol., 2001, Liu, a kol., 2011, Wang, 2003, Zhang, a kol., 2005). Obrázek 13 ukazuje takové vyuţití v detekci nukleových kyselin. Kovy pomocí elektrochemických technik lze velice senzitivně a selektivně stanovit. Pouţitím kvantových teček tvořených z CdS, ZnS, PbS, na které je dále navázaný specifický oligonukleotidový marker, který se váţe na cílovou nukleovou kyselinu imobilizovanou na povrch nanočástic (Han, a kol., 2001, Liu, a kol., 2011, Michalet, a kol., 2005, Zhang, a kol., 2005). Jelikoţ jednotlivé kovy poskytují při elektrochemické detekci signály v různých potenciálech −1.12V (Zn), −0.68V (Cd) a −0.53V (Pb) lze stanovit tři různé specifické nukleové sekvence. Pokud vytvoříme čip, ve kterém budou nanočástice imobilizovány na různá místa vytvoříme tak prostor pro stanovení několika tisíců specifických nukleových kyselin Obrázek 13 (Doria, a kol., 2012).

59

60

Obrázek 13: Schéma postupu při detekci specifických sekvencí pomocí nanočástic, kvantových teček a elektrochemie. Uspořádání elektronanokvantochemického čipu – obrázek nahoře. Princip stanovení ukazuje obrázek dole. A) Připravená jiţ modifikovaná nanočástice jednotlivými oligonukleotidovými sondami, které se na nanočástici váţí prostřednictvím vazby biotin-streptavidin. B) Přidání vzorku k modifikovaným nanočásticím a hybridizace cílových NK na sondy. C) Odstranění interferujících látek promytím. D) Přidání druhé sondy – specifické oligonukleotidy modifikované různými kvantovými tečkami a jejich navázaní k příslušným sekvencím. E) Promytí nanočástic od interferujících látek a nenavázaných sond. F) Elektrochemická detekce jednotlivých kvantových teček respektive cílových sekvencí.

61

4

MATERIÁL A METODIKA

4.2 Materiál a chemikálie Všechny chemikálie a roztoky, není-li uvedeno jinak, byly zakoupeny od firmy Sigma-Aldrich (USA). Izolace poly (A) byla prováděna pomocí paramagnetických částic Dynabeads Oligo (dT)25 od firmy Dynal Biotech ASA (Norsko). Dále byly vyuţity paramagnetické částice MAGNa (Roche). Všechny experimenty s paramagnetickými částicemi byly prováděny za sterilních podmínek v RNA/DNA UV cleaner boxu UVT od firmy Biosan (Litva). K izolaci byl dále pouţíván magnetického stojan MPC–S (Magnetic Particle Concentrator), centrifuga multi-spin MSC-3000 (Biosan) a Thermomixer 5355 Comfort/ Compact (Eppendorf, Německo). Roztoky pouţívané při hybridizaci 100 mM Na2HPO4 + 100 mM NaH2PO4, 0,5 M NaCl, 0,6 M Guanidium thiokyanát, 0,15 M Trizma báze jejíţ pH bylo upraveno pomocí HCl na pH 7,5. 4.2.1 Nanočástice CdNPs byly připraveny s úpravami podle (H. Li, W.Y. Shih, W.H. Shih, Ind. Eng. Chem. Res., 46 (2007) 2013-2019). Cd(NO3)2 • 4H2O (0.03085 g, 0,1 mM) byl rozpuštěn v ACS vodě (25 ml). 3-merkaptopropionová kyselina (35 µl, 0,4 mmol) se pomalu přidávala k míchanému roztoku. Poté se upraví pH na 9,11 pomocí 1M NH3 (1,5 ml). Na2S • 9H2O (0,02402 g, 0,1 mM) ve 23 ml ACS vody byl za intenzivního míchání přidán do prvního roztoku. Výsledný ţlutý roztok se míchá po dobu 1 hodiny. Nanočástice byly skladovány ve tmě při 4 ° C. ZnNPs byly připraveny podobně jako CdNPs s tím, ţe byl pouţit Zn(NO3)2•6H2O (0,02975 g, 0,1 mM). PbNPs byly připraveny modifikovaným postupem podle (Hennequin, B., L. Turyanska, et al. (2008). Advanced Materials 20(19): 3592). Pb(OAc)2•3H2O (0,03794 g, 0,1 mM) byl rozpuštěn v ACS vodě (25 ml). 3-merkaptopropionová kyselina (60 µl, 0,69 mmol) se pomalu přidá k míchanému roztoku. Vznikne bílá sraţenina, ke které se přidá 3,8 ml 1M NH3 (pH = 9,88). Za intenzivního míchání se k roztoku dál přidá Na2S • 9H2O (0,01201 g, 0,05 mM) ve 21,2 ml ACS vody. Vznikne hnědý roztok, který se dál míchá další 1 hodinu. Pb NPs byly skladovány v temnu při teplotě 4 °C.

62

4.2.2 Příprava ODN-SH- NPs ODN-SH 100 µl, (100 µg/ml) se smísilo s roztokem jednotlivých NPs (100 µl). Tato směs se třepala po dobu 24 hodin při laboratorní teplotě na vortexu (Vortex Genie2 (Scientific Industries, USA)). Následně byly roztoky dialyzovány přes 2000 ml miliQ vody (24 h, 4 °C) na membránovém filtru Millipore 0,025 µm VSWP. Během dialýzy byl vzorek zředěn na 800 µl. Zředěný vzorek byl dále zkoncentrován na objem 500 µl pomocí odstředivého filtru Amicon Ultra 3k (Millipore). Centrifuga 5417R (Eppendorf, Německo) byla vyuţita s následujícími parametry 15 min, 4500 rpm, 15 ºC.

4.3 Automatická izolace technikou epMotions Pro izolaci nukleových kyselin byla vyuţita automatická pipetovací stanice epMotion 5075 upravená pro práci s magnetickými částicemi (Eppendorf, Německo). Automatickou pipetovací stanici s označenými pozicemi ukazuje Obrázek 14. Na pozici B4 je umístěn magnetický separátor (Promega). Pozice C1 a C4 jsou termostatované (Epthermoadapter PCR96). Přenos zabezpečuje robotické rameno s pipetovacími nástavci (TS50, TS300, TS1000) a přemisťovacího gripperu (TG-T). Vzorky jsou umístěny v pozici B3 v adaptéru Ep0.5/1.5/2ml. Špičky jsou umístěny v pozicích A4 (ePtips 50), A3 (ePtips 300) a A2 (ePtips 1000). Jako pracovní jednotky byly pouţívány PCR 96 destičky. V pozici B1 je umístěn Module Reservoir, kde jsou k dispozici promývací roztoky a odpadní nádoba. Zařízení je ovládáno pomocí počítače a programu.

4.4 Elektrochemická detekce na rtuťové elektrodě Elektrochemické

stanovení

nukleových

kyselin

bylo

provedeno

pomocí

elektrochemické metody square wave voltametrie (SWV). Pracovní elektroda byla visící rtuťová kapková elektroda (HMDE; s plochou kapky 0,40 mm2). Referenční elektroda byla Ag/AgCl/3M KCl a pomocná elektroda byla uhlíková tyčinka. Měření bylo provedeno pomocí přístroje AUTOLAB analyzátoru (EcoChemie, Holandsko), ve spojení s VA-Stand 663 (Metrohm, Švýcarsko). Základní elektrolyt byl acetátový pufr (pH 5,0). Vzorky byly deoxygenovány argonem (99,99%, 120 s). Výsledky byly vyhodnocovány pomocí softwaru GPES. Parametry SWV byly následující: počáteční

63

potenciál 0 V, konečný potenciál -1.85 V, frekvence 10 Hz, potenciální krok 0,005 V; amplituda 0,025 V. Pro elektrochemickou detekci jednotlivých kovových NPs jsme pouţili diferenční pulzní voltametrii. Parametry elektrochemického stanovení byly následující: Cd (počáteční potenciál -0,9 V; konečný potenciál -0,45 V), Zn (počáteční potenciál -1,2 V; konečný potenciál -0,85 V), Pb (počáteční potenciál -0,6 V; konečný potenciál -0,25 V), ostatní parametry byly stejné jako u (SWV).

rameno

pipety A2 B1 C 4

A3

A2

B3 C1

B4

Obrázek 14: Automatická pipetovací stanice epMotion uzpůsobená pro práci s paramagnetickými částicemi.

4.5 Rostlinný materiál Kukuřice setá (Zea mays L.) F1 hybrid Gila. Zrna kukuřice byly naklíčeny na vlhkém filtračním papíru ve speciálních nádobkách ve tmě při teplotě 23 ± 2 °C. Po 7 dnech po naklíčení byly rostlinky umístěny do nádob obsahující vodovodní vodu a kultivovány v (MLR-350 H, Sanyo, Japan) po dobu 8 dnů se 14 hod světelnou periodou (maximální intenzita světla byla kolem 100 µE.m-2s-1) při teplotě 23,5 – 25 °C a vlhkosti 71 – 78 %. Rostliny rostoucí bez CdCl2 byly pouţity jako kontroly. Další rostliny byly umístěny do nádob s vodovodní vodou, do které byl přidán CdCl2 o koncentraci 10 µM. V těchto nádobách byly rostliny po dobu 21 dní. V intervalu 7, 12,

64

17 a 21 dní byly odebírány vţdy 4 rostliny. Jejich kořeny se třikrát opláchly v destilované vodě a 0,5 M EDTA. Dále byla kaţdá odebraná rostlina rozdělena na nadzemní a podzemní část. Dále byly v práci vyuţity kultury raných somatických embryí (RSE) Smrku obecného (Picea abies /L./ Karst.) klon 2/32. RSE jsou udrţovány na kultivačním médiu LP/2 modifikováno 9 μM kyselinou 2,4-dichlorfenoxyoctovou a 4,4 μM benzylaminopurinem (Havel and Durzan, 1996). pH bylo upraveno na hodnotu 5,7 – 5,8 před autoklávováním (121°C, 100 kPa, 20 min), pomocí KOH/HCl (pH metr Schott CG 842). Při přípravě kultivačního média byly anorganické i organické sloţky rozpuštěny v deionizované destilované vodě (Tuttnauer 3870 EA); organická část byla sterilizována membránovou filtrací (Whatman Puradisc 25 AS 0,2 μm). Na jedné plastikové Petriho misce o průměru 100 mm obsahující 30 ml média bylo kultivováno 10 klastrů. Kultivace probíhala za tmy při teplotě 23±2°C. Pro náš experiment jsme do média přidali Cd-EDTA.

4.6 Polymerázová řetězová reakce PCR byla prováděna pomocí kitu Taq PCR zakoupeného od firmy Biolabs New England (USA). PCR probíhala na termocykleru Mastercycler Gradient od firmy (Eppendorf, Německo) podle následujících kroků. Počáteční denaturace 95 °C po dobu 2 min, 34 cyklů - 94 °C po dobu 15 s, nasedání primerů 55 °C po dobu 15 s a polymerizace při teplotě 72 °C po dobu 45 s. Závěrečná polymerizace při 72 °C po dobu 5 minut a poté byly vzorky schlazeny na +4 °C.

4.7

Mikroskopická analýza RSE Mikroskopické obrázky RSE byly pořízeny pomocí mikroskopu (Olympus AX 70,

Japonsko) ve spojení s digitálním fotoaparátem Olympus 4040. Snímky byly čtyřicet krát zvětšeny a převedeny na digitální obraz v programu Grab-IT (verze 1.3).

65

5

VÝSLEDKY A DISKUSE Výsledková část předkládané dizertační práce je přiloţena ve formě publikací

v odborných časopisech a dále doplněna o komentáře autora. U kaţdé práce je vyznačen i podíl autora na vytvoření publikace, se kterým souhlasí všechny uvedení spoluautoři. I.

Literární rešerše o významu thiolových látek v rostlinách a jejich stanovení pomocí elektrochemických technik.

Supalkova, V.; Huska, D.; Diopan, V.; Hanustiak, P.; Zitka, O.; Stejskal, K.; Baloun, J.; Pikula, J.; Havel, L.; Zehnalek, J.; Adam, V.; Trnkova, L.; Beklova, M.; Kizek, R., Electroanalysis of plant thiols. Sensors 2007, 7 (6), 932-959; IF = 1.774 Podíl autora Húska D.: 10 % textové části práce a 40% experimentální práce II.

Analýza vliv iontů kadmia na raná somatická embrya Smrku ztepilého pomocí elektrochemických technik a nukleární magnetické rezonance.

Huska, D.; Zitka, O.; Krystofova, O.; Adam, V.; Babula, P.; Zehnalek, J.; Bartusek, K.; Beklova, M.; Havel, L.; Kizek, R., Effects of Cadmium(II) Ions on Early Somatic Embryos of Norway spruce Studied by Using Electrochemical Techniques and Nuclear Magnetic Resonance. International Journal of Electrochemical Science 2010, 5 (11), 1535-1549; IF = 2.808 Podíl autora Húska D.: 60 % textové části práce a 80% experimentální práce III. Detekce nukleových kyselin amplifikovaných pomocí PCR za vyuţití miniaturizovaného elektrochemického detektoru. Huska, D.; Hubalek, J.; Adam, V.; Kizek, R., Miniaturized electrochemical detector as a tool for detection of DNA amplified by PCR. Electrophoresis 2008, 29 (24), 4964-4971. IF = 3.569 Podíl autora Húska D.: 50 % textové části práce a 100% experimentální práce IV.

Mikro a nano-trubicemi modifikované pevné elektrody pro detekci nukleových kyselin.

66

Prasek, J.; Huska, D.; Jasek, O.; Zajickova, L.; Trnkova, L.; Adam, V.; Kizek, R.; Hubalek, J., Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids. Nanoscale Research Letters 2011, 6; IF = 2.560 Podíl autora Húska D.: 40 % textové části práce a 50% experimentální práce V.

Automatická izolace nukleových kyselin pomocí paramagnetických částic s elektrochemickou detekcí

Huska, D.; Hubalek, J.; Adam, V.; Vajtr, D.; Horna, A.; Trnkova, L.; Havel, L.; Kizek, R., Automated nucleic acids isolation using paramagnetic microparticles coupled with electrochemical detection. Talanta 2009, 79 (2), 402-411; IF = 3.722 Podíl autora Húska D.: 30 % textové části práce a 80% experimentální práce VI.

Elektrochemická

analýza

rostlinné

mRNA

izolované

pomocí

paramagnetickýc mikro-částic v automatickém systému. Huska, D.; Adam, V.; Babula, P.; Trnkova, L.; Hubalek, J.; Zehnalek, J.; Havel, L.; Kizek, R., Microfluidic robotic device coupled with electrochemical sensor field for handling of paramagnetic micro-particles as a tool for determination of plant mRNA. Microchimica Acta 2011, 173 (1-2), 189-197; IF = 2.578 Podíl autora Húska D.: 50 % textové části práce a 60% experimentální práce VII.

Markery pro posouzení hyperakumulace, senzitivity a rezistence rostlin k těţkým kovům

Článek v přípravě

67

5.2 Význam tiolových látek v rostlinách a jejich elektrochemická analýza 5.2.1 Vědecký článek I

Electroanalysis of Plant Thiols

Supalkova, V.; Huska, D.; Diopan, V.; Hanustiak, P.; Zitka, O.; Stejskal, K.; Baloun, J.; Pikula, J.; Havel, L.; Zehnalek, J.; Adam, V.; Trnkova, L.; Beklova, M.; Kizek, R., Electroanalysis of plant thiols.

Sensors 2007, 7 (6), 932-959 IF = 1.774

Podíl autora Húska D.: 10 % textové části práce a 40% experimentální práce

68

Sensors 2007, 7, 932-959

sensors ISSN 1424-8220 © 2007 by MDPI www.mdpi.org/sensors

Full Paper

Electroanalysis of Plant Thiols Veronika Supalkova 1,2, Dalibor Huska 1,2, Vaclav Diopan 1,2, Pavel Hanustiak 3, Ondrej Zitka 2,4, Karel Stejskal 2,4, Jiri Baloun 1,2, Jiri Pikula 3, Ladislav Havel 1, Josef Zehnalek 2, Vojtech Adam 2,5 , Libuse Trnkova 6, Miroslava Beklova 3 and Rene Kizek 2* 1

Department of Plant Biology, 2 Department of Chemistry and Biochemistry, and 5 Department of Animal Nutrition and Forage Production, Mendel University of Agriculture and Forestry, Zemedelska 1, CZ-613 00 Brno, Czech Republic 3

Department of Veterinary Ecology and Environmental Protection, University of Veterinary and Pharmaceutical Sciences, Palackeho 1-3, CZ-612 42 Brno, Czech Republic 4

Department of Biochemistry, and 6 Department of Chemistry, Faculty of Science, Masaryk University, Kotlarska 2, CZ-611 37 Brno, Czech Republic * Author to whom correspondence should be addressed; E-mail: [email protected] Received: 18 May 2007 / Accepted: 12 June 2007 / Published: 13 June 2007

Abstract: Due to unique physico-chemical properties of –SH moiety thiols comprise wide group of biologically important compounds. A review devoted to biological functions of glutathione and phytochelatins with literature survey of methods used to analysis of these compounds and their interactions with cadmium(II) ions and Murashige-Skoog medium is presented. For these purposes electrochemical techniques are used. Moreover, we revealed the effect of three different cadmium concentrations (0, 10 and 100 μM) on cadmium uptake and thiols content in maize plants during 192 hours long experiments using differential pulse anodic stripping voltammetry to detect cadmium(II) ions and high performance liquid chromatography with electrochemical detection to determine glutathione. Cadmium concentration determined in tissues of the plants cultivated in nutrient solution containing 10 μM Cd was very low up to 96 hours long exposition and then the concentration of Cd markedly increased. On the contrary, the addition of 100 μM Cd caused an immediate sharp increase in all maize plant parts to 96 hours Cd exposition but subsequently the Cd concentration increased more slowly. A high performance liquid chromatography with electrochemical detection was used for glutathione determination in treated maize plants after 96 and 192 hours of treatment. The highest total content of 69

933

Sensors 2007, 7 glutathione per one plant was 6 μg (96 h, 10 μM Cd) in comparison with non-treated plant (control) where glutathione content was 1.5 μg. It can be concluded that electrochemical techniques have proved to be useful to analyse plant thiols. Keywords: plant, thiol, heavy metal, electrochemistry, interaction. Abbreviations: GSH – reduced glutathione; GSSG – oxidized glutathione; PC2 – phytochelatin2; M-PC complex – metal-phytochelatin complex; LMW – low molecular weight; HMW – high molecular weight; MS medium – Murashige-Skoog medium; HMDE – hanging mercury drop electrode; CV – cyclic voltammetry; DPASV – differential pulse anodic stripping voltammetry; SH –sulfhydryl group; FIA – flow injection analysis; HPLC – high performance liquid chromatography; ED – electrochemical detection.

1. Introduction An anthropogenic activity influences directly or indirectly not only an organism but also the whole populations and/or communities [1-3]. A technological development improving our living conditions also brought a plenty of negative effects on ecosystems. One of these effects is pollution of air, soil and water by various types of wastes and undesirable substances such as ash, dust, soot, SO2, CO, CO2, NO, NO2, heavy metals and organic compounds (e.g. phenols, dioxines, polycyclic aromatic hydrocarbons, pesticides). These compounds could be dispersed by air circulation, where they can react with various atmosphere components and fall on the ground, pollute the environment and affect the number of organisms [4]. They can be also transformed to metabolites more dangerous than primary pollutant in biosphere. In addition the polluted environment can influence negatively not only the physiological processes (nutrition uptake, growth, reproduction etc.) of an organism but also chemical properties of soil and that way also rate of decomposition processes. Heavy metals (ρ > 5 g.cm–3) are one of the most toxic and undesirable compounds polluting agricultural products [5-9]. They are natural components of the Earth's crust. To a small extent they enter our bodies via food, drinking water and air. As trace elements, some heavy metals (e.g. copper, selenium, zinc) are essential to maintain the metabolism of the human body. However, other ones such as cadmium, lead, and mercury are toxic at all. At higher concentrations both groups of heavy metals (toxic and essential) lead to poisoning. Heavy metals are also dangerous because they tend to bioaccumulate [10]. That is why the soil with high in heavy metals pose a threat to living organisms [9,11-15]. 1.1 Uptake of heavy metals by plants Besides microorganisms and certain animal species, plants are the main group of organism affected by heavy metals in the soil. Plants have different strategies for uptake, distribution or redistribution of elements, which allow them to maintain stability of the inner environment (homeostasis). It is known

70

934

Sensors 2007, 7

that plants increase solubility and mobility of elements such as iron due to easier and better uptake of them, which could proceed via roots and/or leaves (Fig. 1). The transport of heavy metals inside a plant is affected by number of various mechanisms (Fig. 1). A cell wall is the first barrier against heavy metals entering to plant cell. There heavy metals can be bound by various types of chemicals, first of all, by polysaccharide substances (pectin etc.). Based on the current accepted opinion these interactions are not directly regulated [16]. As for transport of heavy metals into a cell, the changes of H+ concentration could be responsible for passing of a heavy metal through cytoplasmic membrane. This mechanism is strictly controlled by transferring channels, which consume energy and/or use ions gradient. The passing of the metal ions through the membranes can also depend on a presence of carboxylic acids (citric or malic acids) and others substances able to chelate the ions. Besides passing of heavy metals through cytoplasmic membrane into a cell, movement of heavy metals in whole plant is not clear yet. Likely, redistribution of heavy metals occurs via xylem or phloem (Fig. 1). Further, plant has a very few possibilities to excrete heavy metals as follows: a) exudation of heavy metals via roots, b) deposition of them to trichomes and c) to “the oldest” leaves. It clearly follows from these facts that a plant attempts to transport heavy metals on places where they do not menace yet (Fig. 1). The ways of maintaining of heavy metal homeostasis in plants have been reviewed by Clemens [17], Clemens and Simm [18], di Toppi [19] and Cobbett [20].

Metal homeostasis in plant Roots

Trichomes Leaves

Roots Excreting of heavy metals

Changing in free heavy metals concentration

Uptake of heavy metals

Vacuole

Immobilization of metal ions in the cell wall (pectins) Formation of chelates by metal-binding compounds (phytochelatin, glutathione, etc.)

Transpiration

Redistribution of heavy metals?

sp Tran

etals vy m a e h f or t o

spor Tr an

t

av y of h e

meta

l em in x y

ls in

Leaves

em phlo

Apoptosis

Senescence

Figure 1. The basic scheme of maintaining of metals homeostasis and heavy metals distribution at plants [19,20].

71

935

Sensors 2007, 7 Maintaining of cellular heavy metal concentration in a plant cell cell wall γ-Glu-Cys peptides

ATP

ATP+Pi

γ-Glu-Cys peptides

H+

vacuole ?

S2-

LMW Cd-complex

H+

cytosol

Cd2+ HMW Cd,S-complex PC degradation PC

syn t ha sei

Cd2+ H+

H+

Cd2+ Complexation with phytate, polycarboxylic acids

ATP+Pi

nac tive

ATP γ-Glu-Cys peptides

Cd2+

LMW Cd-complex PC s yntha se

- acti

ve

Cd2+

Cd2+

Heavy metals – Cd2+

Figure 2. The scheme of cadmium detoxification by phytochelatins in a plant cell. Cadmium ions are transported through proton pump into the vacuole. Here, cadmium ions activate phytochelatin synthase, which form with the metals ions the M-PC complex (LMW Cd). This complex is consequently transported through tonoplast to vacuole (ATP consumption). Here, low molecular complex is transformed to high molecular weight M-PC complex (HMW M-PC) via –S–S– groups [17,18]. 1.2 Response of plant cells on the presence of heavy metals When heavy metals pass through the cytoplasmic membrane, they can be bound by sulphur rich compounds – metallothionein like proteins, reduced glutathione and phytochelatins (PC), which are present in a cytoplasm. GSH belongs to the most abundant intracellular thiol-peptides, reaching up to 10-3 molar concentrations in certain tissues and organelles [21,22]. As an important antioxidant, GSH plays a role in the detoxification of a variety of electrophilic compounds and peroxides via catalysis by glutathione S-transferases and glutathione peroxidases [23-25]. In addition, GSH is highly reactive and is often found conjugated to other molecules via its sulfhydryl moiety such as NO (Snitrosoglutathione) [26-28]. The synthesis of GSH from its constituent amino acids, L-glutamate, Lcysteine, and L-glycine, involves two ATP-requiring enzymatic steps [29]. GSH serves several vital functions, including 1) detoxifying electrophiles; 2) maintaining the essential thiol status of proteins by 72

936

Sensors 2007, 7

preventing oxidation of -SH groups or by reducing disulfide bonds induced by oxidative stress; 3) scavenging free radicals; 4) providing a reservoir for cysteine; and 5) modulating critical cellular processes such as DNA synthesis, microtubular-related processes, and immune function [29,30]. Moreover GSH can be used for synthesis of phytochelatins (a basic formula (γ-Glu-Cys)n-Gly (n = 2 to 11)) participating in the detoxification of heavy metals at plants, because they have the ability to bind heavy metal ions via SH groups of cysteine units and consequently transport them to vacuole, where an immediate toxicity does not menace yet [31-35]. Complex of PC and a metal ion is called as low molecular weight metal-phytochelatin complex (LMW M-PC). After transporting of this complex through tonoplast to vacuole low molecular complex is transformed to high molecular weight M-PC complex (HMW M-PC) via –S–S– groups. The scheme of detoxification of cadmium in a plant cell is shown in Fig. 2. The synthesis PC itself involves the transpeptidation of the γ-Glu-Cys moiety of GSH onto initially a second GSH molecule to form PC2 or, in later stages of the incubation, onto a PC molecule to produce an n + 1 oligomer (Fig. 2). The reaction is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase (EC 2.3.2.15), which has been called as phytochelatin synthase [20,31,36]. In vitro the purified enzyme was active only in the presence of metal ions. Cadmium was the best activator of phytochelatin synthase followed by Ag, Bi, Pb, Zn, Cu, Hg, and Au cations (Fig. 2). 1.3 Analytical instruments used to study of thiols Several high-performance liquid chromatographic (HPLC) methods applying different detection systems, UV-Vis or fluorescent detector [37-41], electrochemical (ECD) [42-54] and mass spectrometric (MS) [43,55-59] detectors, have been developed for the determination of thiols. Nuclear magnetic resonance, mass spectrometry and other robust analytical techniques can be used for study of interactions of the thiols with metals, however, the high concentrations required for most of the standard techniques of structural determination hinder a more exhaustive study of the geometry of metal–PC complexes [60]. Among of these robust analytical techniques, electrochemical detection (ED) is an attractive alternative method for heavy metal detection, because of its inherent advantages of simplicity, ease of miniaturization, high sensitivity and relatively low cost. Polarographic and voltammetric techniques, especially in pulse mode, have proved to be useful tools not only for the qualitative study of the heavy metal complexes with PC or GSH [61-68], since they provide different signals for the free peptide, the free metal ion and the metal bound in different chemical environments, but also for direct detection of thiols [69-82]. 1.4 The aims In the present work, we aimed on utilizing of various electroanalytical techniques to analyse plant thiols. Primarily, we investigated interactions of GSH and PC2 with cadmium(II) ions using both stationary and flow electrochemical techniques. Further, we revealed the effect of three different cadmium concentrations (0, 10 and 100 μM) on growth of maize plants during 192 hours long experiments. Particularly, we determined changes in cadmium concentration in treated maize plants by

73

937

Sensors 2007, 7

differential pulse anodic stripping voltammetry and thiol content by high performance liquid chromatography with electrochemical detection. 2. Experimental 2.1 Chemicals All analytical reagents of ACS purity were purchased from Sigma Aldrich Chemical Corp. (St. Louis, USA). Murashige-Skoog medium was purchased from Duchefa BV (Netherlands) and its pH was adjusted on 9.2. Phytochelatin (γ-Glu-Cys)2-Gly (PC2) was synthesized in Clonestar Biotech; purity over 90 % (Brno, Czech Republic). Solutions were prepared using deionised ACS water (Sigma). The stock standard solutions of reduced and oxidized glutathione, phytochelatins and thiosalicylic acid (TSA) at 1 mg.ml-1 were prepared with ACS water and stored in the dark at -20 °C. The working standard solutions were prepared daily by dilution of the stock solutions with ACS water and stored in the dark at the temperature of -4 °C. The pH value was measured using WTW inoLab (MultiLab Pilot; Weilheim, Germany), controlled by the personal computer program (MultiLab Pilot; Weilheim, Germany). The pH-electrode (SenTix-H, pH 0–14/3M KCl) was regularly calibrated by set of WTW buffers (Weilheim, Germany). All solutions were filtered through a 0.45 µm Teflon membrane filters (MetaChem, Torrance, USA) prior to HPLC separations. 2.2 Electrochemical measurement Electrochemical measurements were performed with AUTOLAB Analyser (EcoChemie, Netherlands) connected to VA-Stand 663 (Metrohm, Switzerland), using a standard cell with three electrodes. A hanging mercury drop electrode (HMDE) with a drop area of 0.4 mm2 was used as working electrode, an Ag/AgCl/3M KCl electrode as referent ones and a graphite electrode as the auxiliary electrode. For smoothing and baseline correction the software GPES 4.4 supplied by EcoChemie was employed. 2.3 Cyclic voltammetry of thiols The GSH, GSSG and PC2 were measured using cyclic voltammetry. The supporting electrolyte (0.05 M sodium tetraborate, pH 9.2) was used. CV parameters were as follows: the initial potential of –0.2 V, the end potential –0.8 V and step potential 5 mV. The samples of the GSH were reduced before each measurement by 1 mM tris(2-carboxyethyl)phosphine addition according to [45]. 2.4 Differential pulse anodic stripping voltammetry of cadmium(II) ions Acetate buffer pH 5.6 (0.2 M CH3COOH + 0.2 M CH3COONa) was used as a supporting electrolyte. The homogenized samples of maize plants and diluted samples of nutrient solution were deoxygenated prior to measurements by purging with argon (99.999%) saturated with water for 10 min. In addition, samples of nutrient solution were diluted in ratio of 1:100 (v/v) by acetate buffer (pH 5.6). Cadmium concentration was measured by differential pulse anodic stripping voltammetry 74

938

Sensors 2007, 7

(DPASV). The cadmium was deposited on HMDE at potential –0.7 V. During the deposition process (accumulation time 60 s) the solution was stirred at 1450 rpm at room temperature. The scan was initialised at –0.7 V and stopped at 0.0 V. The step potential 5 mV, modulation amplitude 0.05 mV and time interval 0.26 s were used. 2.5 Flow injection analysis coupled with CouloChem III electrochemical detector A flow injection analysis with electrochemical detection (FIA-ED) system consisted of solvent delivery pump operating in range of 0.001-9.999 ml/min (Model 583 ESA Inc., Chelmsford, MA, USA), a guard cell (Model 5020 ESA, USA), a reaction coil (1 m) and an electrochemical detector. The electrochemical detector (ED) includes one low volume flow-through analytical cell (Model 5040, ESA, USA), which consists of a glassy carbon working electrode, a reference palladium electrode and an auxiliary carbon electrode, and CouloChem III as a control module. The obtained data were treated by CSW 32 software (Version 1.2.4, Data Apex, Czech Republic). The experiments were carried out at room temperature. Guard cell potential was 0 V. Britton-Robinson buffer (pH = 2.0) was used as the mobile phase. The sample (5 μl) was injected manually. A glassy carbon electrode was polished mechanically by 0.1 μm of alumina (ESA Inc., USA) and sonicated at the laboratory temperature for 5 min using a Sonorex Digital 10 P Sonicator (Bandelin, Berlin, Germany) at 40 W. 2.6 High performance liquid chromatography coupled with CoulArray electrochemical detector A high performance liquid chromatography with electrochemical detection (HPLC-ED) system consisted from two solvent delivery pumps operating in the range of 0.001-9.999 ml.min-1 (Model 582 ESA Inc., Chelmsford, MA), a Metachem Polaris C18A reversed-phase column (150.0 × 2.1 mm, 5 μm particle size; Varian Inc., CA, USA) and a CoulArray electrochemical detector (Model 5600A, ESA, USA). The electrochemical detector includes two flow cells (Model 6210, ESA, USA). Each cell consists of four analytical cells containing working carbon porous electrode, two auxiliary and two reference electrodes. Both the detector and the reaction column were thermostated. The sample (5 µl) was injected manually. Thiosalicylic acid (TSA) was used as internal standard for determination the thiol compounds. HPLC-ED conditions as follows – mobile phase: 80 mM trifluoroacetic acid and methanol with a gradient profile starting at 97:3 (TFA:methanol) kept constant for first 8 min, then decreasing to 85:15 during one minute and kept constant for 8 min, and finally increasing linearly up to 97:3 from 17 to 18 min. Flow rate 0.8 ml.min-1, column and detector temperature 25 °C and electrode potential 900 mV were set [44,47]. 2.7 Plant material Maize (Zea mays L.) F1 hybrid Gila was used in our experiments. Maize kernels germinated on wet filter paper in the vessels at 23 ± 2 °C in the dark. When the roots reached approximately 2 cm, the twenty five seedlings were placed into vessels contained 8 l modified aerated Richter′s nutrient solution [83]. The concentrations of macroelements per 1 l were 0.5 g Ca(NO3)2, 0.2 g KNO3, 0.2 g KH2PO4, 0.25 g MgSO4.7 H2O [83]. Iron in the form of Fe-EDTA was added to the nutrient solution 75

939

Sensors 2007, 7

(10 mg Fe per 1 l). Microelements were added to the nutrient solution in the form of Hoagland′s AZ solution [84]. Plants were cultivated in a greenhouse in April 2006, in daylight (maximal light intensity was about 200 µEm-2s-1), at a temperature 23.5–25 °C and humidity 71–78 % (Fig. 3A). After 14 days, when the plants had developed five leaves, CdCl2 was added to the nutrient solution at a final concentration of 10 or 100 µM, respectively. Plants cultivated without the presence of CdCl2 served as a control. The maize plants placed in the vessels that contained modified aerated Richter′s nutrient solution with addition of CdCl2 (0, 10 and 100µM) were cultivated during the time of 192 hours. Ten plants were harvested at certain time intervals (0, 24, 48, 96 and 192 h) during the experiment and its roots were rinsed (three times) in distilled water and 0.5 M EDTA. In addition, each harvested plant was divided into leaves, shoot and root (Fig. 3B). Five plants were used for the determination of GSH content and fresh weight and another five plants were used for the determination of dry weight and cadmium concentration. Experimental scheme

A

B control plant

7

leaf 5- L5 leaf 4- L4

5

stem Addition of Cd

2

79

○

3

26

25

77

Temperature (oC)

4

24

75

23

73

leaf 3- L3

shoot leaf 2- L2 Humidity (%) ▲

Transpired amount of nutrient solution / plant FW (g/ g )

6

leaf 1- L1

1 22

71 0

4

8

12 16 20

roots

Time of cultivation (day)

0 0

48

96

144

192

Treatment time (h)

Figure 3. Experimental scheme of maize plant used for cadmium and thiols determination (A). Total transpiration of control plants; transpiration was calculated according the procedure given in Material and methods. In inset: dependence of temperature and humidity during maize cultivation in greenhouse (0 – 22 days); the arrow indicates cadmium addition (B). 2.8 Sample preparation for cadmium determination Plant parts (0.4 g of fresh plant material) were digested by an ETHOS SEL microwave digestion furnace (Milestone S.r.l, Italy) using a MDR 300/10 module. A three step procedure (i. 120 s, 250 W; 76

940

Sensors 2007, 7

ii. 120 s, 0 W (120 °C); iii. 10 min 250 W (180 °C) with addition of 5 ml 65% HNO3 and 3 ml H2O was used. The clear digest was quantitatively transferred into a volumetric flask and diluted up to 25 ml with water. 2.9 Preparation of plant tissues for determination of thiols Weighed plant tissues (approximately 0.2 g) were transferred to a test-tube. Then, liquid nitrogen was added to the test-tube, and the samples were frozen. The frozen sample was transferred to mortar and spread for 1 min. Then exactly 1 000 μl of 0.2 M phosphate buffer (pH 7.2) was added to mortar, and the sample was spread for following 5 min. The homogenate was transferred to a new test-tube. The mixture was homogenised by shaking on a Vortex–2 Genie (Scientific Industries, New York, USA) at 4 °C for 30 min. The homogenate was centrifuged (14 000 g) for 30 min at 4 °C using a Universal 32 R centrifuge (Hettich-Zentrifugen GmbH, Tuttlingen, Germany). Before the analysis the supernatant was filtered through a membrane filter (0.45 μm Nylon filter disk, Millipore, Billerica, Mass., USA). 2.10 Transpiration Transpired amounts of water were determined on the basis of nutrient solution mass decrease and according to the increase of fresh weight of three plants. Sartorius scale was used for measurement of fresh weight. For other details see in Ref. No. [85]. 2.11 Statistical analysis STATGRAPHICS® (Statistical Graphics Corp®, USA) was used for statistical analyses. Results are expressed as mean ± S.D. unless noted otherwise. Differences with p < 0.05 were considered significant. 3. Results and Discussion Due to increasing production and consumption of plant food it is necessary to control amounts of undesirable chemical compounds. The chemicals come into agro-ecosystem especially from fertilizers, pesticides and industrial toxic products containing heavy metals and toxic organic substances. In addition it is well known that heavy metals markedly influence growth of plants. That is why the study of plant response to heavy metals stress is especially important for the understanding of many biological processes [77,86-88]. Cadmium (Cd) is a toxic nonessential heavy metal that can be taken up by organisms [89]. It has been designated as a human carcinogen and in some cases a potent multitissue animal carcinogen [89]. In plants Cd is also recognized to be one of the most phytotoxic metal pollutants. An excess of Cd typically causes a number of hallmarks of heavy metal poisoning, such as growth retardation, leaf chlorosis, changes of enzyme activities, altered stomatal function etc. [90]. Moreover, Cd itself can affect photosynthesis, transpiration and nutrient accumulation. Its presence in plant cell could also trigger programmed cell death [87,91,92]. Transport of Cd through plant organism may be influenced by different factors, such as transpiration [85], plant chelators [31,93] and Cd uptake by the roots [86,94]. The molecular mechanisms of Cd toxicity are not precisely known but SHgroups of proteins and competition with Ca2+ ions are two possible targets of Cd2+ ions in cells [95]. 77

941

Sensors 2007, 7 3.1 Investigation of interaction between heavy metals and thiols 3.1.1 Phytochelatin and cadmium(II) ions

To analyse thiols a battery of analytical instruments can be used as mentioned in “Introduction” section. Electrochemical techniques measuring redox or catalytic signals are suitable not only for detection of thiols but also for study of their interactions with various substances. It is a common knowledge that PC is able to bind heavy metals [20,96]. Thus, we were interested in the issue if we would be able to observe the interaction of PC2 with cadmium(II) ions by cyclic voltammetry. We added cadmium(II) ions to PC2 solution, then, the mixture was vortexed on a Vortex–2 Genie (Scientific Industries, New York, USA) at room temperature for 15 min. Phytochelatin without any heavy metal ions gives a typical cyclic voltammogram shown in Fig. 4A. We found out that reductive signal of phytochelatin2 decreased and signal corresponding to phytochelatin – cadmium(II) complex increased with increasing concentration of the heavy metal (Fig. 4A,B,C). The dependence obtained exponentially decreased according to the equation: y = 90.383e-0.0067x; R2 = 0.9924 and could be divided into two dependences: i) sharp decrease (y = -0.3473x + 83.666; R2 = 0.9799; Fig. 4Ca) and ii) more gradual decrease (y = -0.0745x + 37.649; R2 = 0.9566; Fig. 4Ba). A

C

Phytochelatin

100

PC; 0 μM

80

PC; 10 μM PC;50 μM

a

100

Peak height (%)

50 nA

50 0 0

PC; 100 μM

50

100

150

B

–0.6 Potential (V)

–0.4

Peak height (%)

–0.8

Cd 2+

Peak height (%)

PC2 concentration (μM)

60

100

b

50

40

0 150

250

350

450

PC2 concentration (μM)

20

100 nA y = 90.383e

-0.0067x

2

R = 0.9924

scan Cd 2+ –0.8

–0.7

–0.6

–0.5

0 0

–0.4

–0.3

–0.2

100

200

300

400

500

PC2 concentration (μM)

Potential (V)

Figure 4. Interaction of phytochelatin with cadmium measured with Autolab Analyser. (A) Cyclic voltammograms of phytochelatin (10, 50 and 100 μM). (B) Influence of phytochelatin additions (0 – 500 μM) on cadmium signals (150 μM). Arrows indicate changes of cadmium signals with increasing phytochelatin concentration. (C) Dependence of decrease of cadmium signal (150 μM of cadmium(II) ions) on phytochelatin additions (0 – 500 μM), changes within the range of (a) 0 – 150 μM and (b) 150 -500 μM. Peak height of 100% corresponds to 717 nA. CV parameters were as follows: the initial potential of –0.2 V, the end potential –0.8 V and step potential 5 mV. 78

942

Sensors 2007, 7 3.1.2 Glutahione and Murashige-Skoog medium

Further, we utilized CV to analyse interaction of other biologically important thiol, glutathione, with more complex mixture – plant cultivation medium. Optimal composition of cultivation media for plants has been investigated and tested for many years. Media for plant cultivation contain macro- and microelements, phytohormones, vitamins, carbon sources and osmotic potential in the best balanced ratio. The influence of individual components on plant growth is still not clear due to a number of reactions between certain components and, most probably, between organism metabolites and components of the medium. Murashige-Skoog (MS) medium is most commonly used for in vitro plant cultivation. A number of experimental works have been devoted to the study of the influence of both organic and inorganic components of this medium on cell cultures [97,98]. Several authors described the influence of GSH added to cultivation medium on cell cultures [97]. GSH is a highly reactive molecule and, thus, has the ability to bind different ions, functional groups and/or toxic compounds via their SH group and to influence composition of the medium. By means of these interactions the concentration of reduced glutathione could be decreased. GSH (100 µM) was added to borate buffer with increasing volume of MS medium. The typical dependence of signal height on the volume of added MS medium is shown in Fig. 5A. Thiols interaction with heavy metals

A

B GSH 100 µM

100

GSH 100 µM in ½ MS medium

100

y = -4.0508x + 98.252

80

Peak height (%)

Peak height (%)

90

60

40

80

200 nA

70

scan

scan

0h

20

60

4h 8h

50

0 0

25

50

75

100

Content of MS medium in supporting electrolyte (%)

0

1

2

3

4

5

6

7

8

Time of interaction (h)

Figure 5. (A) Changes in concentration of “free” GSH with increasing concentration of MS medium to supporting electrolyte, time of interaction 4 min, stirring 1400 rpm and deoxygenating by argon. (B) Dependence of GSH concentration on time of interaction with ½ MS medium; in inset: typical voltammograms of GSH measured in ½ MS medium at 0, 4 and 8 h long interaction. GSH concentration 100 µM, temperature 25 °C. Peak height of 100 % corresponds to 390 nA. The slow decrease of the signal up to 70 % (v/v) content of the medium in supporting electrolyte was observed. When the concentration increased above 70%, the decrease of the glutathione signal was sharper. At the highest amounts of MS medium the glutathione signal was 11 % of original value and the concentration of free GSH was about 10 µM, what is ten times lower than initially added 79

943

Sensors 2007, 7

amount of GSH. The time of the interaction was 4 minutes with intensive stirring and deoxygenating with argon. This time of the interaction was relatively short. Thus we studied the interaction of GSH and MS in the time scale up to eight hours. The obtained experimental dependence of the glutathione concentration on the time of interaction is shown in Fig. 5B. The GSH amount decreased more than 30 % during the experiment. This means that the decreasing correlation between the time of interaction and GSH content resulted (y = -4.0508x + 98.252). Based on the results obtained we assumed that GSH interacted with inorganic components of MS medium, most of all, with metal ions such as zinc(II), copper(II), cobalt(II) [99,100]. 3.1.3 Thiols and cadmium(II) ions Moreover, we attempted to utilize flow injection analysis with electrochemical detection (FIA-ED) to study interactions between thiols (GSH, GSSG and PC2) and cadmium(II) ions. Therefore, we had to characterize the thiols by means of FIA-ED, while glassy carbon electrode served as working one. The most suitable flow rate of mobile phase (Britton-Robinson, pH 2.0) for determination of the thiols was 1 ml/min. The typical hydrodynamic voltammograms of GSH, GSSG and PC2 are shown in Fig. 6A. We studied the current responses of the thiols with the range from 500 to 1,000 mV. The current responses increased with increasing potential. The maximal responses for GSH and PC2 were obtained within potential from 750 to 900 mV, whereas GSSG gave the highest signal at the highest applied potential. The highest current responses give GSH (three times higher in comparison with GSSG signals), whereas the lowest responses give PC2 (inset in Fig. 6A). The differences in the current responses are probably associated with size of the molecules analysed and with accessibility of their electroactive moieties to be oxidized on the surface of the working electrode. Moreover, we studied the influence of thiols concentration on their signals. The signals obtained were well developed and symmetric (inset in Fig. 6A). As soon as we have characterized the behaviour of thiols measured by FIA-ED, we aimed on studying their interactions with heavy metals. We were interested in the issue if we can observe interactions between PC2 and cadmium(II) ions using FIA-ED as we were able, when we utilized CV for the same purposes (described above). It is clear from the results obtained that we were able to follow the interaction using FIA-ED. Particularly, decrease in PC2 signal with increasing concentration of cadmium(II) ions was observed in the flow-amperometric record (Fig. 6Ba). To our knowledge, free –SH moieties in PC2 molecule not only have the highest affinity to heavy metals but also show the highest electroactivity. PC2 signal decreased markedly with increasing cadmium(II) concentration up to 40 µM. This sudden decrease is probably associated with binding of cadmium(II) into all free –SH moieties of phytochelatins (Fig. 6Bb). In addition, the PC2 signal decreased with cadmium(II) dose higher than 50 µM more gradually, which can be associated with interactions of cadmium(II) ions with other free moieties in PC2 molecule (e.g. –NH).

80

944

Sensors 2007, 7

A

B 100

a

60

1 µM

5 µA

flow

Cadmium(II) ions addition 10 µA

40

100

b

20

60

80

PC2 peak height (%)

Peak height (%)

flow

1.5 µM

80

500 nM

80

PC2

PC2

Peak height (%)

100

0 GSH

GSSG

P C2

40

20

GSH

60

40

20

GSSG PC2 0

0 200

400 600 Applied potential (V)

800

1000

0

25

50

75

100

Cadmium(II) concentration (µM)

Figure 6. (A) Hydrodynamic voltammograms of GSH, GSSG and PC2 (1 μM), temperature 25 °C; inset: comparison of peak heights of GSH, GSSG and PC2 and flow-amperometric responses of PC2 (0.5, 1 and 1.5 µM). Peak height of 100 % corresponds to 890 µA. (Ba) Flow-amperometric record of interaction of PC2 (14 µM) with cadmium(II) ions (0, 20, 40, 65, 88 and 110 µM). (Bb) Dependence of PC2 peak height on increasing concentration of cadmium(II) ions. Potential: 900 mV. 3.2 Effect of cadmium(II) ions on growth of maize plants After we have investigated the interaction between thiols and cadmium ions, the influence of cadmium(II) ions on maize plants was studied. After 14 days long cultivation the maize plants were used for the study of the influence of three different cadmium concentrations (0, 10 and 100 µM) on their growth during 192 hours long treatment. Ten maize plants were harvested in certain time intervals (0, 24, 48, 96 and 192 h). The harvested plants were divided into leaves, stems and roots and the obtained plant parts were homogenised and analysed. Five plants were used for the determination of GSH content and fresh weight and the other five for the determination of dry weight and Cd concentrations. The next important factor that influenced plant growth is transpiration. Transpiration was determined on the basis of nutrient solution mass decrease and according to the increase of fresh weight of plants according to Zaidi et al. [85]. Results of nutrient solution mass decrease were recalculated on 1 g fresh weight of plant (Fig. 3B). In the certain experimental time intervals (0, 24, 48, 96, and 192 h) plant samples were used to construct growth curves. Significant inhibition of plant growth was not observed at 10 µM Cd in nutrient solution in comparison with the control plant (Fig. 7). On the other hand, in nutrient solution containing 100 µM Cd significant growth depression of leaves, stems and roots was observed. The 81

945

Sensors 2007, 7

plants cultivated at the highest Cd concentration (100 µM) had brown leaves tips and very poorly developed root systems. The morphological differences between control plants and plants treated by 100 µM Cd were observed already after 24 h (not shown). Growth curves for fresh and dry weights of treated maize plants are shown in Figs. 7A,B, respectively. Both, dry and fresh weights of maize plants cultivated at 10 µM Cd increase almost linearly with time (Figs. 7A,B) on the contrary to 100 µM Cd dosage where maize plants growth reached a maximum after 96 hours (Fig. 7A,B) and then growth depression probably followed. Even after 48 hours, differences of plant growth curves for both cadmium concentrations were significant. Similar differences were also described in chickpea root and tobacco [101-103]. Growth curves for fresh and dry weights of non-treated maize plants are shown in Fig. 7A,B and are almost similar to growth curves of maize plants treated by 10 µM Cd. Growth curves B

A

6

Shoot 100 µM Cd

Shoot 100 µM Cd

Root 10 µM Cd

Root 10 µM Cd Root 100 µM Cd

Root 100 µM Cd

5

Shoot 10 µM Cd

0.40

Shoot 10 µM Cd

Root control

Dry weight (g)

Fresh weight (g)

Shoot control

Shoot control

7

4 3

0.30

Root control

0.20

2 0.10

1 0

0.00

0

50

100

150

200

Treatment time (h)

0

50

100

150

200

Treatment time (h)

Figure 7. Dependences of fresh weight: FW (A), and dry weight: DW (B) of maize plant parts on cadmium treatment time. Maize plants (hybrid Gila) were cultivated hydroponically for 192 h and the roots were treated with or without 10 and 100 µM Cd. Data are expressed as means (n = 5). 3.3 Cadmium concentration changes in nutrient solution Primarily we focused on determination of cadmium concentration changes in nutrient solution during 196 h long experiment. These changes could be used to evaluate the plant`s ability to uptake Cd from the nutrient solution. Electrochemical determination of cadmium in nutrient solution was accomplished by differential pulse anodic stripping voltammetry (DPASV). The typical voltammograms of simultaneous determination of zinc(II), cadmium(II), lead(II) and cupper(II) (5, 10, 20 and 39 nM) are shown in inset in Fig. 8A. The calibration curves in acetate buffer (Fig. 8A) is strictly linear with R2 = 0.99. The detection limits for the heavy metals as 3 S/N were evaluated as units and tens of pM. This very sensitive detection method was used due to precise detection of very small cadmium concentration changes in nutrient solution.

82

946

Sensors 2007, 7

30

Zinc

Zinc

250

B

y = 0.3201x + 1.2798 R2 = 0.9983

39 nM

100

25

200 Copper y = 2.5161x - 2.1567

Copper

20

R2 = 0.9973

0 -0.5 Potential (V)

Cadmium

5 nM -1.0

15

Lead

10 nM

150

y = 0.2347x - 0.089 R2 = 0.9978

100 10

50 5

Peak height ● (nA)

Cadmium

20 nM

Peak height ●, ●, ● (nA)

10 µM Cd 100 µM Cd

30 nA

Concentration in nutrient solution (%)

A

control 80

60

40

20

Lead y = 0.0861x - 0.164 R2 = 0.9937

0 0

20

40

60

Concentration of heavy metals (nM)

80

0 100

0 0

40

80 120 160 Treatment time (h)

200

Figure 8. Electrochemical determination of zinc, cadmium, lead and copper by DPASV; calibration curve of heavy metals in acetate buffer (pH 5.6) (A); tA 60 s at –0.7 V; Estart –0.7 V; Estop 0 V, step potential 5 mV, modulation amplitude 0.05 mV, time interval 0.26 s; changes of cadmium content in nutrient solution during cultivation of plants (B); initial concentration of cadmium was taken as 100 %. Exactly 10 ml of nutrient solution were taken from cultivating vessels during the experiment at specified time intervals (0, 24, 48, 96 and 192 h). Each sample was diluted in ratio of 1:100 (v/v) by acetate buffer (pH 5.6) before analysis. Cadmium concentration in nutrient solution without maize plants that was determined by DPASV was not changed during 192 h (deviation around 5 %, not shown). We did not want to change any experimental parameters so we did not add any new nutrient solution during the cultivation. That is why we were sure that the water volume in nutrient solution in vessels had fallen and, simultaneously, Cd concentration had changed according to transpiration. After re-estimating of cadmium(II) concentration on the transpired amount of water the concentration in nutrient solution was decreasing faster at dosage 10 µM than 100 µM (Fig. 8B) [85]. The concentration of cadmium in cultivating vessels decreased up to about 20/60 % of initially applied 10/ 100 µM Cd, respectively, at the end of experiment (Fig. 8B). 3.4 Cadmium concentration changes in plants In addition we electrochemically determined concentration of cadmium in different parts (leaves, stems and roots) of maize plants by DPASV (Fig. 9). We found out very interesting trend in Cd uptake by plants. Cadmium concentration was very low in all parts of maize plants cultivated in nutrient 83

947

Sensors 2007, 7

solution containing 10 µM Cd for 96 hours of treatment and then the concentration of Cd in all studied plant parts markedly increased (Fig. 9). This sudden increase probably relates with failure of root protective mechanisms that can prevent in uptake of heavy metals by plant [17,104]. Marked decrease of cadmium concentration in nutrient solution with initially 10 µM Cd concentration is shown in Fig. 8B. On the other hand maize plants did not almost receive any cadmium from nutrient solution during first 96 hours of treatment (Fig. 9). The disproportion probably relates with cadmium adsorption on surface of roots and, consequently, the adsorbed cadmium was cleared away using EDTA before analysis [77]. Cadmium concentration in plants 80

B

500

control

Stem 100

40 200

20 100

0

0 0

40

80

120

160

Treatment time (h)

200

• Concentration of Cd (μg/g DW)

• Concentration of Cd (μg/g DW)

300

80

400

100 µM Cd

60

300

40

200

20

100

0

0 0

40

80

120

Treatment time (h)

160

200

10 µM Cd 100 µM Cd

400

1500

300

1000

200 500 100

0

Δ Concentration of Cd (μg/g DW)

60

10 µM Cd

Δ Concentration of Cd (μg/g DW)

400

Δ Concentration of Cd (μg/g DW)

100 µM Cd

2000

control

500

control

10 µM Cd

Root

C

500

• Concentration of Cd (μg/g DW)

A

Leaves

0 0

40

80

120

160

200

Treatment time (h)

Figure 9. Dependences of cadmium contents in leaves (A), stem (B), and root (C) on cadmium treatment time. On the contrary, the dosage of 100 µM Cd caused the immediate and sharp increase of cadmium concentration in stems and leaves to 96 hours of treatment but after that the Cd concentration in stems and leaves increased more slowly (Fig. 9). Concentration of cadmium in roots of maize plants exposed by the highest cadmium concentration (100 µM Cd) markedly increased to 48 hours, between 48 and 96 hours of treatment increased very slowly but from 96 to 192 hours concentration of cadmium again markedly increased. Protective mechanisms contained in roots, which obstruct in uptake of heavy metals by plant, were probably damaged due to high and toxic cadmium concentration (100 µM Cd) already in the beginning of the experiment. That is why cadmium was easily transported to the plant by root immediately in the beginning of experiment. Increase of cadmium concentration in all parts of plants to 96 hours of treatment probably relates with active transport of nutrients from roots to aboveground parts of plants [105]. After 96 hours of treatment, the transport pathways were probably damaged by cadmium presence and its concentration increase only in roots (Fig. 9). Due to damaging of the transport pathways, the transport of nutrients from roots to other parts of plants were insufficient and consequently we observed the growth depression (Fig. 7) [105-108]. The highest concentrations of Cd were determined in roots in comparison with other studied parts of plants treated by 10 and/or 100 µM Cd. Approximately the same concentrations of cadmium were detected in leaves and stems of

84

948

Sensors 2007, 7

plants treated by 10 and/or 100 µM Cd. The same results were obtained in oilseed rape and tomato [109,110]. 3.5 Electrochemical determination of thiols 3.5.1 Cyclic voltammetry of the thiols Electrochemical behaviour of certain thiols measured on the surface of mercury electrode in the presence of phosphate buffer has already been described [73]. On the other hand, the behaviour in the presence of other supporting electrolytes can differ seriously. Here we analysed three thiols (reduced GSH and oxidized GSSG glutathione, and phytochelatin PC2) in the presence of 0.05 M sodium tetraborate (pH 9.6). We chose this buffer because it belongs to the most commonly used buffers in electroanalysis. Cyclic voltammograms were recorded within the potential range from -0.2V to -0.8 V, whereas potential of -0.8 V was vertex potential. The typical voltammogram of certain compounds of interest has been obtained (Fig. 10A). GSH gave signal at potential PGSH (–0.44 V), GSSG peak PGSSG (–0.69 V) and PC2 peak PPC2 (–0.62 V). As for GSH, there are evident both reductive and oxidative signals [26]. The reductive signal corresponds to reduction of GS-Hg complex. In addition oxidative signal probably relates with oxidizing of GSH to GSSG [76] (Fig. 10Aa). Similar mechanisms could be expected for analysis of phytochelatin (Fig. 10Ac). Electrochemical study of thiols Glutathione - GSH

a

C

8

–0.8

H2 N

O S

HO

100 nA

NH2 NH

S

O

NH

OH O

–0.8

O

O

–0.4 –0.6 Potential (V)

GSSG

-0.50

y = 0.3189x - 0.0486

OH

HN HN

GSH

6

–0.2

–0.4 –0.6 Potential (V)

Glutathione - GSSG

O

O

100 nA

OH

O

b

O

-0.45

Peak height (nA)

NH 2

R 2 = 0.9999

O

NH

NH

HO

y = 0.4431x + 0.0054

7

SH

O

-0.40

GSH

200 μM of thiols O

HO

B

Scan rate 5, 25 and 50 mV/s

R 2 = 0.9965

5

4

Peak potential (V)

A

PC2

3 y = 0.2311x - 0.0085

–0.2

-0.55

PC2 -0.60

R 2 = 0.9933

2

c

Phytochelatin

GSSG

-0.65

1 O H

CH2

HN C HOOC

H

CH2SH

H

C

NH

C

CH2 NH

(γ-glutamylcysteinyl)n

C

COOH

100 nA

CH2 glycin

-0.70

0

O

0 –0.8

–0.4 –0.6 Potential (V)

–0.2

5

10

15

Concentration (μM)

20

0

500

1000

Concentration (μM)

Figure 10. Electrochemical behaviour of reduced (GSH) and oxidized glutathione (GSSG) and phytochelatin2 (PC2). (A; a,b,c) Chemical formulas of GSH, GSSG and PC2, and their typical cyclic voltammograms. Thiol concentration 200 μM and scan rates (5, 25 and 50 mV/s). Dependence of (B) height and (C) potential of thiols signals on concentration (0 – 20 μM). Scan rates: 20 mV/s. Supporting electrolyte (0.05 M Na2B4O7, pH 9.2). CV parameters were as follows: step potential 5 mV, start potential –0.2 V, vertex potential –0.8 V, deoxygenating by argon for 140 s. 85

949

Sensors 2007, 7

On the other hand, GSSG is probably reduced on the surface of HMDE with consequent GSH formation. The formed GSH molecules could be oxidized. Voltammograms obtained by analysis of GSSG confirm these presumptions because they consist from several processes (there are three well observable signals, Fig. 10Ab). Time after Cd addition: 10 μM Cd

control 10 µM Cd / 96 h

2.5

10 µM Cd / 192 h

2.0 1.5 1.0 0.5 0.0 L1

L3

L4

L5

800 600 400

30

control

25

10 µM Cd / 96 h

20

10 µM Cd / 192 h

15 10 5 0

200

L1

L2

L3

L4

L5

0 L1

stem root

L2

L3

L4

L5

stem

root

Time after Cd addition: 100 μM Cd 3.00

control 2.50

100 µM Cd / 96 h 100 µM Cd / 192 h

2.00

1.50

1.00

0.50

0.00 L1

L2

L3

L4

L5

stem root

2400 2000 1600 1200 800

Cadmium concentration (µg.g-1 DW)

GSH content/fresh weight (μg/g FW)

B

L2

1000

Cadmium concentration (µg.g-1 DW)

3.0

1200

Cadmium concentration (µg.g-1 DW)

GSH content/fresh weight (μg/g FW)

3.5

Cadmium concentration (µg.g-1 DW)

A

400

120 control

100

100 µM Cd / 96 h

80

100 µM Cd / 192 h

60 40 20 0 L1

L2

L3

L4

L5

0 L1

L2

L3

L4

L5

stem

root

Figure 11. Glutathione contents and cadmium concentrations in maize plants after treating 10 µM Cd (A) 100 µM Cd (B). Sample was collected at the time 0, 96 and 192 h. We found out that processes taking place on a surface of working electrode are strongly influenced by a supporting electrolyte and its pH [111]. We assume that a thiol would firstly be adsorbed on a surface of working electrode and then a compound of the thiol with mercury would be formed. After that electrode reaction of the thiol-mercury compound would take place. In our following experiments, we investigated the influence of scan rates (10, 20, 40, 80, 160, 320 and 640 mV/s) on reductive signals of the thiols. We observed that the height of the analysed thiols signals increased proportionally with increasing scan rate (GSH, R2 = 0.98; GSSG, R2 = 0.87; and PC2 R2 = 0.99). The potentials of the peaks shifted about 0.8 mV per 100 mV/s to more positive potentials. In addition we investigated dependence of thiols signals on their concentration (0 – 20 μM). The dependences were obtained at scan rate of 20 mV.s-1 by dilution of stock solutions of thiols and were 86

950

Sensors 2007, 7

linear (GSH, y = 0.4431x + 0.0054, R2 = 0.9999; GSSG, y = 0.3189x - 0.0486, R2 = 0.9965; and PC, y = 0.2311x - 0.0085, R2 = 0.9933) with R.S.D. 6.5% (Fig. 10B). When we analysed thiols in the concentration range from 0 to 1,000 μM, we found out that the GSH signal shifted to a more negative potential and the potentials of GSSG and PC2 to more positive ones with their decreasing concentration. If the concentration of thiols decreased below 10 μM, they gave reductive signal at the same potential (–0.53 V), Fig. 10B. 3.5.2 Changes in content of thiols in maize plants Detoxification mechanisms based on the synthesis of phytochelatins is the most probable explanation of the observed plant response at Cd presence. Many authors have observed that the most expressed effect of heavy metals in plants is easily observable in roots [101,102,112-116]. Roots are the most important gates for heavy metals uptake and that is why non-protein thiol compounds synthesised from glutathione as a response to stress factors are mainly presented in roots [104]. Thus, we analysed the level of glutathione in various maize parts (including roots) by optimised HPLC-ED method optimized by Petrlova et al. [44] and Potesil et al. [47]. GSH contents and cadmium concentrations in individual parts of plants exposed to Cd (0, 10 and 100 µM Cd) after 96 and 192 h of treatment are shown in Fig. 11A,B. The relatively high GSH content in the leaf L1 and the stem are the most interesting findings. The content of GSH decreased from the oldest to the youngest leaves. Observed changes in GSH content according to time of exposition were also very interesting. The GSH content maximum was reached close to 96 h and then the amount of GSH gradually decreased in plants exposed to 10 µM Cd. In plants exposed to cadmium dosage 100 µM, on the other hand, amounts of GSH increased continuously till the end of the experiment. The highest GSH contents were detected in stem, root and leaf L1. Again the tendency to a decrease in GSH content is evident in younger leaves (Fig. 11B). Number of authors has also observed changes in glutathione content during exposition by different stress factors [112,117,118]. On the other hand, a recent study of the regulation of phytochelatin synthesis in marine green alga has been published, where the authors have shown that glutathione content was constant [119]. We obtained surprising results for the total concentrations of Cd and GSH in a whole plant (Fig. 12). Concentration of Cd in one plant according to treatment time is shown in Fig. 12A. Cadmium concentration in plants treated by 100 µM Cd increased almost linearly according to treatment time. On the other hand, Cd concentration in plants cultivated in nutrient solution containing 10 µM Cd markedly increased after 96 h of exposition. In addition, we determined cadmium concentrations in individual parts of maize plants (Fig. 12B). Finally we showed GSH content per a plant (Fig. 12C), because we attempted to observe the heavy metal stress response in whole organism exposed to the heavy metal. GSH content in roots did not change according to time of exposition and Cd concentration (Fig. 12C). This trend could suggest that protection mechanisms in roots are triggered by very low concentrations of a heavy metal. The maximal concentration of GSH was determined in the leaves of plants exposed to a lower cadmium dosage (10 µM Cd). The higher Cd dosage caused significant depression of GSH concentration that is probably related to phytochelatin synthesis [44,101,112]. 87

951

Sensors 2007, 7 A

2500

100 µM Cd

160

C

B

10 µM Cd

6

control

120

80

40

2000

control 10 µM Cd / 96 h

10 µM Cd / 192 h

5

100 µM Cd / 96 h

GSH content (µg/one plant)

Cadmium concentration (µg/one plant)

Cd concentration (µg/one plant)

10 µM Cd / 96 h

100 µM Cd / 192 h

1500

1000

500

10 µM Cd / 192 h 100 µM Cd / 96 h 100 µM Cd / 192 h

4

3

2

1

0 0

48

96

144

Treatment time (h)

192

0

0 Leaves

Stem

Root

Total

Leaves

Stem

Root

T otal

Figure 12. Cadmium concentration in one whole maize plant (A); cadmium concentration (B) and glutathione content (C) in individual parts of maize plants. Conclusion As we have shown, electroanalytical techniques enable easy and rapid analysis of thiols. Moreover, these techniques could be utilized to study interactions between thiols and metals. Acknowledgements The work on this project was supported by grants GACR 522/07/0692, 1M06030, INCHEMBIOL MSMT 0021622412, IGA MZLU 20/2007 and MSMT 6215712402. References 1. 2. 3. 4. 5.

Kizek, R.; Vacek, J.; Trnkova, L.; Klejdus, B.; Kuban, V. Electrochemical biosensors in agricultural and environmental analysis. Chem. Listy 2003, 97, 1003-1006. Zehnalek, J.; Adam, V.; Kizek, R. Influence of heavy metals on production of protecting compounds in agriculture plants. Lis. Cukrov. Reparske 2004, 120, 222-224. Zehnalek, J.; Vacek, J.; Kizek, R. Application of higher plants in phytoremetiation of heavy metals. Lis. Cukrov. Reparske 2004, 120, 220-221. Pulford, I.D.; Riddell-Black, D.; Stewart, C. Heavy metal uptake by willow clones from sewage sludge-treated soil: The potential for phytoremediation. Int. J. Phytoremediation 2002, 4, 59-72. Singh, K.P.; Mohan, D.; Sinha, S.; Dalwani, R. Impact assessment of treated/untreated wastewater toxicants discharged by sewage treatment plants on health, agricultural, and environmental quality in the wastewater disposal area. Chemosphere 2004, 55, 227-255.

88

952

Sensors 2007, 7 6. 7.

8.

9. 10. 11.

12. 13. 14.

15. 16. 17. 18.

19. 20. 21. 22.

Shrotriya, N.; Joshi, J.K.; Mukhiya, Y.K.; Singh, V.P. Toxicity assessment of selected heavymetals, herbicides and fertilizers in agriculture. Int. J. Environ. Stud. 1984, 22, 245-248. Endo, T.; Haraguchi, K.; Cipriano, F.; Simmonds, M.P.; Hotta, Y.; Sakata, M. Contamination by mercury and cadmium in the cetacean products from Japanese market. Chemosphere 2004, 54, 1653-1662. Bordajandi, L.R.; Gomez, G.; Abad, E.; Rivera, J.; Fernandez-Baston, M.D.; Blasco, J.; Gonzalez, M.J. Survey of persistent organochlorine contaminants (PCBs, PCDD/Fs, and PAHs), heavy metals (Cu, Cd, Zn, Pb, and Hg), and arsenic in food samples from Huelva (Spain): Levels and health implications. J. Agr. Food. Chem. 2004, 52, 992-1001. Fargasova, A. Toxicity comparison of some possible toxic metals (Cd, Cu, Pb, Se, Zn) on young seedlings of Sinapis alba L. Plant Soil Environ. 2004, 50, 33-38. Sharma, R.K.; Agrawal, M. Biological effects of heavy metals: An overview. J.Environ.Biol. 2005, 26, 301-313. Barocsi, A.; Csintalan, Z.; Kocsanyi, L.; Dushenkov, S.; Kuperberg, J.M.; Kucharski, R.; Richter, P.I. Optimizing phytoremediation of heavy metal-contaminated soil by exploiting plants stress adaptation. Int. J. Phytoremediation 2003, 5, 13-23. Bukvic, G.; Antunovic, M.; Popovic, S.; Rastija, M. Effect of P and Zn fertilisation on biomass yield and its uptake by maize lines (Zea mays L.). Plant Soil Environ. 2003, 49, 505-510. Garcia, G.; Zanuzzi, A.L.; Faz, A. Evaluation of heavy metal availability prior to an in situ soil phytoremediation program. Biodegradation 2005, 16, 187-194. Hanzlik, P.; Jehlicka, J.; Weishauptova, Z.; Sebek, O. Adsorption of copper, cadmium and silver from aqueous solutions onto natural carbonaceous materials. Plant Soil Environ. 2004, 50, 257264. Smejkalova, M.; Mikanova, O.; Boruvka, L. Effects of heavy metal concentrations on biological activity of soil micro-organisms. Plant Soil Environ. 2003, 49, 321-326. Cohen-Shoel, N.; Ilzycer, D.; Gilath, I.; Tel-Or, E. The involvement of pectin in Sr-2+ biosorption by Azolla. Water Air Soil Pollut. 2002, 135, 195-205. Clemens, S. Molecular mechanisms of plant metal tolerance and homeostasis. Planta 2001, 212, 475-486. Clemens, S.; Simm, C. Schizosaccharomyces pombe as a model for metal homeostasis in plant cells: the phytochelatin-dependent pathway is the main cadmium detoxification mechanism. New Phytol. 2003, 159, 323-330. di Toppi, L.S.; Gabbrielli, R. Response to cadmium in higher plants. Environ. Exp. Bot. 1999, 41, 105-130. Cobbett, C.S. Phytochelatins and their roles in heavy metal detoxification. Plant Physiol. 2000, 123, 825-832. Meister, A.; Anderson, M.E. Glutathione. Annu. Rev. Biochem. 1983, 52, 711-760. Kruusma, J.; Benham, A.M.; Williams, J.A.G.; Kataky, R. An introduction to thiol redox proteins in the endoplasmic reticulum and a review of current electrochemical methods of detection of thiols. Analyst 2006, 131, 459-473.

89

953

Sensors 2007, 7

23. Brazdova, M.; Kizek, R.; Havran, L.; Palecek, E. Determination of glutathione-S-transferase traces in preparations of p53 C-terminal domain (aa320-393). Bioelectrochemistry 2002, 55, 115118. 24. Mannervik, B.; Danielson, U.H. Glutathione Transferases - Structure and Catalytic Activity. Crc Crit. Rev. Biochem. 1988, 23, 283-337. 25. Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-Transferases - First Enzymatic Step in Mercapturic Acid Formation. J. Biol. Chem. 1974, 249, 7130-7139. 26. Vitecek, J.; Petrlova, J.; Petrek, J.; Adam, V.; Potesil, D.; Havel, L.; Mikelova, R.; Trnkova, L.; Kizek, R. Electrochemical study of S-nitrosoglutathione and nitric oxide by carbon fibre NO sensor and cyclic voltammetry - possible way of monitoring of nitric oxide. Electrochim. Acta 2006, 51, 5087-5094. 27. Mayer, B.; Pfeiffer, S.; Schrammel, A.; Koesling, D.; Schmidt, K.; Brunner, F. A new pathway of nitric oxide cyclic GMP signaling involving S-nitrosoglutathione. J. Biol. Chem. 1998, 273, 32643270. 28. Clancy, R.M.; Levartovsky, D.; Leszczynskapiziak, J.; Yegudin, J.; Abramson, S.B. Nitric-Oxide Reacts with Intracellular Glutathione and Activates the Hexose-Monophosphate Shunt in Human Neutrophils - Evidence for S-Nitrosoglutathione as a Bioactive Intermediary. Proc. Natl. Acad. Sci. U. S. A. 1994, 91, 3680-3684. 29. Lu, S.C. Regulation of hepatic glutathione synthesis: current concepts and controversies. Faseb J. 1999, 13, 1169-1183. 30. Schafer, F.Q.; Buettner, G.R. Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free Radic. Biol. Med. 2001, 30, 1191-1212. 31. Cobbett, C.S. Phytochelatin biosynthesis and function in heavy-metal detoxification. Curr. Opin. Plant Biol. 2000, 3, 211-216. 32. Rauser, W.E. Phytochelatins and Related Peptides - Structure, Biosynthesis, and Function. Plant Physiol. 1995, 109, 1141-1149. 33. Rauser, W.E. Phytochelatins. Annu. Rev. Biochem. 1990, 59, 61-86. 34. Grill, E.; Loffler, S.; Winnacker, E.L.; Zenk, M.H. Phytochelatins, the Heavy-Metal-Binding Peptides of Plants, Are Synthesized from Glutathione by a Specific Gamma-Glutamylcysteine Dipeptidyl Transpeptidase (Phytochelatin Synthase). Proc. Natl. Acad. Sci. U. S. A. 1989, 86, 6838-6842. 35. Grill, E.; Winnacker, E.L.; Zenk, M.H. Phytochelatins, a Class of Heavy-Metal-Binding Peptides from Plants, Are Functionally Analogous to Metallothioneins. Proc. Natl. Acad. Sci. U. S. A. 1987, 84, 439-443. 36. Ramos, J.; Clemente, M.R.; Naya, L.; Loscos, J.; Perez-Rontome, C.; Sato, S.; Tabata, S.; Becana, M. Phytochelatin synthases of the model legume Lotus japonicus. A small multigene family with differential response to cadmium and alternatively spliced variants. Plant Physiol. 2007, 143, 1110-1118. 37. Kawakami, S.K.; Gledhill, M.; Achterberg, E.P. Determination of phytochelatins and glutathione in phytoplankton from natural waters using HPLC with fluorescence detection. Trac-Trends Anal. Chem. 2006, 25, 133-142.

90

954

Sensors 2007, 7

38. Bramanti, E.; Toncelli, D.; Morelli, E.; Lampugnani, L.; Zamboni, R.; Miller, K.E.; Zemetra, J.; D'Ulivo, A. Determination and characterization of phytochelatins by liquid chromatography coupled with on line chemical vapour generation and atomic fluorescence spectrometric detection. J. Chromatogr. A 2006, 1133, 195-203. 39. Bramanti, E.; Lomonte, C.; Onor, M.; Zamboni, R.; D'Ulivo, A.; Raspi, G. Mercury speciation by liquid chromatography coupled with on-line chemical vapour generation and atomic fluorescence spectrometric detection (LC-CVGAFS). Talanta 2005, 66, 762-768. 40. Kang, S.H.; Kim, J.W.; Chung, D.S. Determination of homocysteine and other thiols in human plasma by capillary electrophoresis. J. Pharmaceut. Biomed. 1997, 15, 1435-1441. 41. Kand'ar, R.; Zakova, P.; Lotkova, H.; Kucera, O.; Cervinkova, Z. Determination of reduced and oxidized glutathione in biological samples using liquid chromatography with fluorimetric detection. J. Pharm. Biomed. Anal. 2007, 43, 1382-1387. 42. Hiraku, Y.; Murata, M.; Kawanishi, S. Determination of intracellular glutathione and thiols by high performance liquid chromatography with a gold electrode at the femtomole level: comparison with a spectroscopic assay. BBA-Gen. Subjects 2002, 1570, 47-52. 43. Norris, R.L.; Eaglesham, G.K.; Shaw, G.R.; Smith, M.J.; Chiswell, R.K.; Seawright, A.A.; Moore, M.R. A sensitive and specific assay for glutathione with potential application to glutathione disulphide, using high-performance liquid chromatography-tandem mass spectrometry. J. Chromatogr. B 2001, 762, 17-23. 44. Petrlova, J.; Mikelova, R.; Stejskal, K.; Kleckerova, A.; Zitka, O.; Petrek, J.; Havel, L.; Zehnalek, J.; Adam, V.; Trnkova, L.; Kizek, R. Simultaneous determination of eight biologically active thiol compounds using gradient elution-liquid chromatography with Coul-Array detection. J. Sep. Sci. 2006, 29, 1166-1173. 45. Petrlova, J.; Potesil, D.; Mikelova, R.; Blastik, O.; Adam, V.; Trnkova, L.; Jelen, F.; Prusa, R.; Kukacka, J.; Kizek, R. Attomole voltammetric determination of metallothionein. Electrochim. Acta 2006, 51, 5112-5119. 46. Potesil, D.; Mikelova, R.; Adam, V.; Kizek, R.; Prusa, R. Change of the protein p53 electrochemical signal according to its structural form - Quick and sensitive distinguishing of native, denatured, and aggregated form of the "guardian of the genome". Protein J. 2006, 25, 2332. 47. Potesil, D.; Petrlova, J.; Adam, V.; Vacek, J.; Klejdus, B.; Zehnalek, J.; Trnkova, L.; Havel, L.; Kizek, R. Simultaneous femtomole determination of cysteine, reduced and oxidized glutathione, and phytochelatin in maize (Zea mays L.) kernels using high-performance liquid chromatography with electrochemical detection. J. Chromatogr. A 2005, 1084, 134-144. 48. Spadaro, A.; Bousquet, E.; Santagati, N.A.; Vittorio, F.; Ronsisvalle, G. Simple analysis of glutathione in human colon carcinoma cells and epidermoid human larynx carcinoma cells by HPLC with electrochemical detection. Chromatographia 2005, 62, 11-15. 49. Salimi, A.; Hallaj, R. Catalytic oxidation of thiols at preheated glassy carbon electrode modified with abrasive immobilization of multiwall carbon nanotubes: applications to amperometric detection of thiocytosine, L-cysteine and glutathione. Talanta 2005, 66, 967-975.

91

955

Sensors 2007, 7

50. Zhang, W.; Wan, F.L.; Zhu, W.; Xu, H.H.; Ye, X.Y.; Cheng, R.Y.; Jin, L.T. Determination of glutathione and glutathione disulfide in hepatocytes by liquid chromatography with an electrode modified with functionalized carbon nanotubes. J. Chromatogr. B 2005, 818, 227-232. 51. Hiraku, Y.; Murata, M.; Kawanishi, S. Determination of intracellular glutathione and thiols by high performance liquid chromatography with a gold electrode at the femtomole level: comparison with a spectroscopic assay. Biochim. Biophys. Acta-Gen. Subj. 2002, 1570, 47-52. 52. Zhang, S.; Sun, W.L.; Xian, Y.Z.; Zhang, W.; Jin, L.T.; Yamamoto, K.; Tao, S.G.; Jin, J.Y. Multichannel amperometric detection system for liquid chromatography to assay the thiols in human whole blood using the platinum microelectrodes chemically modified by copper tetraaminophthalocyanine. Anal. Chim. Acta 1999, 399, 213-221. 53. Zitka, O.; Stejskal, K.; Kleckerova, A.; Adam, V.; Beklova, M.; Horna, A.; Supalkova, V.; Havel, L.; Kizek, R. Utilizing electrochemical techniques for detection of biological samples. Chem. Listy 2007, 101, 225-231. 54. Xu, F.; Wang, L.; Gao, M.N.; Jin, L.T.; Jin, J.Y. Amperometric determination of glutathione and cysteine on a Pd-IrO2 modified electrode with high performance liquid chromatography in rat brain microdialysate. Anal. Bioanal. Chem. 2002, 372, 791-794. 55. Klejdus, B.; Zehnalek, J.; Adam, V.; Petrek, J.; Kizek, R.; Vacek, J.; Trnkova, L.; Rozik, R.; Havel, L.; Kuban, V. Sub-picomole high-performance liquid chromatographic/mass spectrometric determination of glutathione in the maize (Zea mays L.) kernels exposed to cadmium. Anal. Chim. Acta 2004, 520, 117-124. 56. Petrek, J.; Vitecek, J.; Vlasinova, H.; Kizek, R.; Kramer, K.J.; Adam, V.; Klejdus, B.; Havel, L. Application of computer imaging, stripping voltammetry and mass spectrometry to study the effect of lead (Pb-EDTA) on the growth and viability of early somatic embryos of Norway spruce (Picea abies/L./Karst.). Anal. Bioanal. Chem. 2005, 383, 576-586. 57. El-Zohri, M.H.A.; Cabala, R.; Frank, H. Quantification of phytochelatins in plants by reversedphase HPLC-ESI-MS-MS. Anal. Bioanal. Chem. 2005, 382, 1871-1876. 58. Gomez-Ariza, J.L.; Garcia-Barrera, T.; Lorenzo, F.; Bernal, V.; Villegas, M.J.; Oliveira, V. Use of mass spectrometry techniques for the characterization of metal bound to proteins (metallomics) in biological systems. Anal. Chim. Acta 2004, 524, 15-22. 59. Rellan-Alvarez, R.; Hernandez, L.E.; Abadia, J.; Alvarez-Fernandez, A. Direct and simultaneous determination of reduced and oxidized glutathione and homoglutathione by liquid chromatographyelectrospray/mass spectrometry in plant tissue extracts. Anal. Biochem. 2006, 356, 254-264. 60. Kupper, H.; Mijovilovich, A.; Meyer-Klaucke, W.; Kroneck, P.M.H. Tissue- and age-dependent differences in the complexation of cadmium and zinc in the cadmium/zinc hyperaccumulator Thlaspi caerulescens (Ganges ecotype) revealed by X-ray absorption spectroscopy. Plant Physiol. 2004, 134, 748-757. 61. Sestakova, I.; Mader, P. Voltammetry on mercury and carbon electrodes as a tool for studies of metallothionein interactions with metal ions. Cell. Mol. Biol. 2000, 46, 257-267. 62. Alberich, A.; Arino, C.; Diaz-Cruz, J.M.; Esteban, M. Multivariate curve resolution applied to the simultaneous analysis of electrochemical and spectroscopic data: Study of the Cd(II)/glutathione-

92

956

Sensors 2007, 7

63.

64.

65.

66.

67. 68.

69. 70.

71. 72.

73. 74.

75. 76.

77.

fragment system by voltammetry and circular dichroism spectroscopy. Anal. Chim. Acta 2007, 584, 403-409. Huska, D.; Zitka, O.; Adam, V.; Beklova, M.; Krizkova, S.; Zeman, L.; Horna, A.; Havel, L.; Zehnalek, J.; Kizek, R. A sensor for investigating the interaction between biologically important heavy metals and glutathione. Czech J. Anim. Sci. 2007, 52, 37-43. Cruz, B.H.; Diaz-Cruz, J.M.; Sestakova, I.; Velek, J.; Arino, C.; Esteban, M. Differential pulse voltammetric study of the complexation of Cd(II) by the phytochelatin (gamma-Glu-Cys)(2)Gly assisted by multivariate curve resolution. J. Electroanal. Chem. 2002, 520, 111-118. Adam, V.; Zehnalek, J.; Petrlova, J.; Potesil, D.; Sures, B.; Trnkova, L.; Jelen, F.; Vitecek, J.; Kizek, R. Phytochelatin modified electrode surface as a sensitive heavy-metal ion biosensor. Sensors 2005, 5, 70-84. Krizkova, S.; Adam, V.; Petrlova, J.; Zitka, O.; Stejskal, K.; Zehnalek, J.; Sures, B.; Trnkova, L.; Beklova, M.; Kizek, R. A suggestion of electrochemical biosensor for study of Platinum(II)-DNA interactions. Electroanalysis 2007, 19, 331-338. Petrlova, J.; Potesil, D.; Zehnalek, J.; Sures, B.; Adam, V.; Trnkova, L.; Kizek, R. Cisplatin electrochemical biosensor. Electrochim. Acta 2006, 51, 5169-5173. Prusa, R.; Petrlova, J.; Kukacka, J.; Adam, V.; Sures, B.; Beklova, M.; Kizek, R. Study of interaction of glutathiones and metallothionein with cytostatics. Clin. Chem. 2006, 52, A175A175. Vasilescu, I.; Litescu, S.; Radu, G.L. Electrochemical study of pH influence on the behaviour of the cystine-cysteine system. Rev. Chim. 2006, 57, 955-959. Serrano, N.; Sestakova, I.; Diaz-Cruz, J.M.; Arino, C. Adsorptive accumulation in constant current stripping chronopotentiometry as an alternative for the electrochemical study of metal complexation by thiol-containing peptides. J. Electroanal. Chem. 2006, 591, 105-117. Tang, H.; Chen, J.H.; Nie, L.H.; Yao, S.Z.; Kuang, Y.F. Electrochemical oxidation of glutathione at well-aligned carbon nanotube array electrode. Electrochim. Acta 2006, 51, 3046-3051. Dorcak, V.; Sestakova, I. Electrochemical behavior of phytochelatins and related peptides at the hanging mercury drop electrode in the presence of cobalt(II) ions. Bioelectrochemistry 2006, 68, 14-21. Han, H.Y.; Tachikawa, H. Electrochemical determination of thiols at single-wall carbon nanotubes and PQQ modified electrodes. Front. Biosci. 2005, 10, 931-939. Mladenov, M.; Mirceski, V.; Gjorgoski, I.; Jordanoski, B. Redox kinetic measurements of glutathione at the mercury electrode by means of square-wave voltammetry. The role of copper, cadmium and zinc ions. Bioelectrochemistry 2004, 65, 69-76. Budnikov, G.K.; Ziyatdinova, G.K.; Valitova, Y.R. Electrochemical determination of glutathione. J. Anal. Chem. 2004, 59, 573-576. Kizek, R.; Vacek, J.; Trnkova, L.; Jelen, F. Cyclic voltammetric study of the redox system of glutathione using the disulfide bond reductant tris(2-carboxyethyl)phosphine. Bioelectrochemistry 2004, 63, 19-24. Vacek, J.; Petrek, J.; Kizek, R.; Havel, L.; Klejdus, B.; Trnkova, L.; Jelen, F. Electrochemical determination of lead and glutathione in a plant cell culture. Bioelectrochemistry 2004, 63, 347351. 93

957

Sensors 2007, 7

78. Calvo-Marzal, P.; Chumbimuni-Torres, K.Y.; Hoehr, N.F.; Neto, G.D.; Kubota, L.T. Determination of reduced glutathione using an amperometric carbon paste electrode chemically modified with TTF-TCNQ. Sens. Actuator B-Chem. 2004, 100, 333-340. 79. Salimi, A.; Pourbeyram, S. Renewable sol-gel carbon ceramic electrodes modified with a Rucomplex for the amperometric detection of L-cysteine and glutathione. Talanta 2003, 60, 205214. 80. Seymour, E.H.; Wilkins, S.J.; Lawrence, N.S.; Compton, R.G. Electrochemical detection of glutathione: An electrochemically initiated reaction pathway. Anal. Lett. 2002, 35, 1387-1399. 81. Zeng, B.Z.; Ding, X.G.; Zhao, F.Q. Voltammetric response of glutathione and 3mercaptopropionic acid self-assembled monolayer modified gold electrodes to Cu(II). Electroanalysis 2002, 14, 651-656. 82. Supalkova, V.; Petrek, J.; Baloun, J.; Adam, V.; Bartusek, K.; Trnkova, L.; Beklova, M.; Diopan, V.; Havel, L.; Kizek, R. Multi-instrumental investigation of affecting of early somatic embryos of Spruce by cadmium(II) and lead(II) ions. Sensors 2007, 7, 743-759. 83. Richter, O. Beiträge zur Ernährungsphysiologie der Kulturgräser. I. Uber das grosse Eisenbedürfnis der Reispflanze (Oriza sativa L.). Sitz.-Ber. Akad. Wiss. 1926, 203-242. 84. Hoagland, D.R.; Snyder, W.C. Nutrition of strawberry under controlled conditions. (a) Effects of deficies of boron and certain other elements, (b) susceptibility to injury from sodium salts. Proc. Amer. Soc. Horticult. Sci. 1933, 1930, 288 - 294. 85. Zaidi, P.H.; Rafique, S.; Singh, N.N. Response of maize (Zea mays L.) genotypes to excess soil moisture stress:morpho-physiological effects and basis of tolerance. Europ. J. Agronomy 2003, 19, 383-399. 86. Rauser, W.E.; Meuwly, P. Retention of cadmium in roots of maize seedlings - role of complexation phytochelatins and related thiol peptides. Plant Physiol. 1995, 109, 195-202. 87. di Toppi, S.L.; Gabbrielli, R. Response to cadmium in higher plants. Environ. Exp. Bot. 1999, 41, 105-130. 88. Strouhal, M.; Kizek, R.; Vecek, J.; Trnkova, L.; Nemec, M. Electrochemical study of heavy metals and metallothionein in yeast Yarrowia lipolytica. Bioelectrochemistry 2003, 60, 29-36. 89. Waalkes, M.P. Cadmium carcinogenesis in rewiew. J. Inorg. Biochem. 2000, 79, 241-244. 90. Kosobrukhov, A.; Knyazeva, I.; Mudrik, V. Plantago major plants responses to increase content of lead in soil: Growth and photosynthesis. Plant Growth Reg. 2004, 42, 145-151. 91. Prasad, M.N.V. Cadmium toxicity and tolerance in vascular plants. Environ. Exp. Bot. 1995, 35, 525-545. 92. Fojtova, M.; Kovarik, A. Genotoxic effect of cadmium is associated with apoptotic changes in tobacco cells. Plant Cell Environ. 2000, 23, 531-537. 93. Cobbett, C.S.; Goldsbrough, P.B. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant Biol. 2002, 53, 159–182. 94. Stolt, J.P.; Sneller, F.E.C.; Bryngelsson, T.; Lundborg, T.; Schat, H. Phytochelatin and cadmium accumulation in wheat. Environ. Exp. Bot. 2003, 49, 21-28. 95. Cosio, C.; Martinoia, E.; Keller, C. Hyperaccumulation of cadmium and zinc in Thlaspi caerulescens and Arabidopsis halleri at the leaf cellular level. Plant Physiol. 2004, 134, 716-725.

94

958

Sensors 2007, 7

96. Grill, E.; Winnacker, E.L.; Zenk, M.H. Phytochelatins: the principal heavy-metal complexing peptides of higher plants. Science 1985, 320, 674-676. 97. Urdaneta, A.; Jimenez, A.R.; Izquierdo, D.; Paramio, M.T. Effect of the addition of glutathione and glucose to the culture medium on embryo development of IVM-IVF prepubertal goat oocytes. Zygote 2003, 11, 131-138. 98. Inoue, Y.; Moriyasu, Y. Degradation of membrane phospholipids in plant cells cultured in sucrose-free medium. Autophagy 2006, 2, 244-246. 99. Zechmann, B.; Muller, M.; Zellnig, G. Intracellular adaptations of glutathione content in Cucurbita pepo L. induced by treatment with reduced glutathione and buthionine sulfoximine. Protoplasma 2006, 227, 197-209. 100. Nunez-Vergara, L.J.; Squella, J.A.; Olea-Azar, C.; Bollo, S.; Navarrete-Encina, P.A.; Sturm, J.C. Nitrosobenzene: electrochemical, UV-visible and EPR spectroscopic studies on the nitrosobenzene free radical generation and its interaction with glutathione. Electrochim. Acta 2000, 45, 3555-3561. 101. Vogeli-Lange, R.; Wagner, G.J. Subcellular localization of cadmium and cadmium-binding peptides in tobacco leaves. Plant Physiol. 1990, 92, 1086-1093. 102. Gupta, D.K.; Tohoyama, H.; Joho, M.; Inouhe, M. Possible roles of phytochelatins and glutathione metabolism in cadmium tolerance in chickpea roots. J. Plant Res. 2002, 115, 429-437. 103. Mazen, A.M.A. Calcium oxalate deposits in leaves of Corchorus olitotius as related to accumulation of toxic metals. Russ. J. Plant Physiol. 2004, 51, 281-285. 104. Potters, G.; De Gara, L.; Asard, H.; Horemans, N. Ascorbate and glutathione: guardians of the cell cycle, partners in crime? Plant. Physiol. Bioch. 2002, 40, 537-548. 105. Wang, Y.; Fang, J.; Leonard, S.S.; Rao, K.M.K. Cadmium inhibits the electron transfer chain and induces reactive oxygen species. Free Radic. Biol. Med. 2004, 36, 1434-1443. 106. Lux, A.; Sottnikova, A.; Opatrna, J.; Greger, M. Differencens in structure of adventitious roots in Salix clones with contrasting characteristics of cadmium accumulation and sensitivity. Physiol Plantarum 2004, 120, 537-545. 107. Lai, H.-Y.; Chen, Z.-S. Effects of EDTA on solubility of cadmium, zinc, and lead and their uptake by rainbow pink and vetiver grass. Chemosphere 2004, 55, 421-430. 108. Romero-Puertas, M.C.; Palma, J.M.; Gomez, M.; Del Rio, L.A.; Sandalio, L.M. Cadmium causes the oxidative modification of proteins in pea plants. Plant Cell Environ. 2002, 2002, 677-686. 109. Bartolf, M.; Brennan, E.; Price, C.A. Partial characterization of a cadmium-binding protein from the roots of cadmium-treated tomato. Plant Physiol. 1980, 66, 438-441. 110. Carrier, P.; Baryla, A.; Havaux, M. Cadmium distribution and microlocalization in oilseed rape (Brassica napus) after long-term growth on cadmium-contaminated soil. Planta 2003, 216, 939950. 111. Heyrovsky, M.; Mader, P.; Vavricka, S.; Vesela, V.; Fedurco, M. The anodic reaction at mercury electrodes due to cystein. J. Electroanal. Chem. 1997, 430, 103-117. 112. Vogeli-Lange, R.; Wagner, G.J. Relationship between cadmium, glutathione and cadmiumbinding peptides (phytochelatins) in leaves of intact tobacco seedlings. Plant Sci. 1996, 114, 1118. 113. Kahle, H. Response of roots of trees to heavy metals. Environ. Exp. Bot. 1993, 33, 99-119. 95

959

Sensors 2007, 7

114. Inouhe, M.; Ito, R.; Ito, S.; Sasada, N.; Tohoyama, H.; Joho, M. Azuki bean cells are hypersensitive to cadmium and do not synthesize phytochelatins. Plant Physiol. 2000, 123, 10291036. 115. Inouhe, M.; Ninomiya, S.; Tohoyama, H.; Joho, M.; Murayama, T. Different characteristics of roots in the cadmium-tolerance and Cd-binding complex formation between mono- and dicotyledonous plants. J. Plant. Res. 1994, 107, 201-207. 116. Chen, Y.X.; He, Y.F.; Luo, Y.M.; Yu, Y.L.; Lin, Q.; Wong, M.H. Physiological mechanism of plant roots exposed to cadmium. Chemosphere 2003, 50, 789-793. 117. Leopold, I.; Gunther, D.; Schmidt, J.; Neumann, D. Phytochelatins and heavy metal tolerance. Phytochemistry 1999, 50, 1323-1328. 118. Hu, S.X.; Lau, K.W.K.; Wu, M. Cadmium sequestration in Chlamydomonas reinhardtii. Plant Sci. 2001, 161, 987-996. 119. Tsuji, T.; Hirayanagi, N.; Iwabe, O.; Namba, T.; Taqawa, M.; Miyamoto, S.; Miyasaka, H.; Takagi, M.; Hirata, K.; Miyamoto, K. Regulation of phytochelatin synthesis by zinc and cadmium in marine green alga, Dunaliella tertiolecta. Phytochemistry 2003, 62, 453-459. © 2007 by MDPI (http://www.mdpi.org). Reproduction is permitted for noncommercial purposes.

96

5.2.2 Literární rešerše o významu tiolových látek v rostlinách a jejich stanovení pomocí elektrochemických technik. V tomto článku sumarizujeme biologické funkce tiolových látek jako je glutation a fytochelatiny a ukazujeme vyuţití elektrochemických metod k analýze tiolových látek a jejich interakcí s ionty kadmia (II). Sledovali jsme různé koncentrace kademnatých iontů (0, 10 a 100 µM) a jejich vliv na samotný příjem kademnatých iontů rostlinou a na obsah tiolových látek u rostlin kukuřice seté během 192 hodin. U rostlin vystavených 10 µM koncentraci Cd2+ bylo v rostlinných pletivech v prvních 96 hodinách detekované velmi malé mnoţství Cd2+. Jeho hladina výrazně stoupla aţ po této době. Pokud byly rostliny kultivovány za přítomnosti 100 µM kademnatých iontů, byla detekována jeho vysoká koncentrace ve všech částech rostliny ihned po expozici. Po 96 hodinách se ale hladina Cd2+ v rostlinných pletivech zvyšovala uţ jen pozvolna. V případě tiolových látek, byl nejvyšší celkový obsah glutationu (6 µg) stanoven u rostlin vystavených 10 µM koncentraci Cd2+ ve srovnání s kontrolními rostlinami, kde byl obsah glutationu stanoven na 1,5 µg. V tomto článku jasně ukazujeme vhodnost pouţití elektrochemických technik pro analýzu interakcí Cd iontů s tiolovými látkami a také moţnost detekovat jednotlivé sloţky a vyuţít tak tyto techniky pro určování vhodnosti rostlin pro fytoremediace.

97

5.3 Studium vlivu kademnatých iontů na raná somatická embrya smrku ztepilého 5.3.1 Vědecký článek II

Effects of Cadmium(II) Ions on Early Somatic Embryos of Norway spruce Studied by Using Electrochemical Techniques and Nuclear Magnetic Resonance. Huska, D.; Zitka, O.; Krystofova, O.; Adam, V.; Babula, P.; Zehnalek, J.; Bartusek, K.; Beklova, M.; Havel, L.; Kizek, R., International Journal of Electrochemical Science 2010, 5 (11), 1535-1549; IF = 2.808

Podíl autora Húska D.: 60 % textové části práce a 80% experimentální práce

98

Int. J. Electrochem. Sci., 5 (2010) 1535 - 1549 International Journal of

ELECTROCHEMICAL SCIENCE www.electrochemsci.org

Effects of Cadmium(II) Ions on Early Somatic Embryos of Norway spruce Studied by Using Electrochemical Techniques and Nuclear Magnetic Resonance Dalibor Huska 1, Ondrej Zitka 1, Olga Krystofova 1, Vojtech Adam 1, Petr Babula 2, Josef Zehnalek 1, Karel Bartusek 3, Miroslava Beklova 4, Ladislav Havel 5 and Rene Kizek 1, * 1

Department of Chemistry and Biochemistry, and 5 Department of Plant Biology, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno, Czech Republic 2 Department of Natural Drugs, Faculty of Pharmacy, and 4 Department of Veterinary Ecology and Environmental Protection, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences, Palackeho 1-3, CZ-612 42 Brno, Czech Republic 3 Institute of Scientific Instruments, Academy of Sciences of the Czech Republic, Kralovopolska 147, CZ-612 00 Brno, Czech Republic * E-mail: [email protected] Received: 29 September 2010 / Accepted: 15 October 2010 / Published: 1 November 2010

Studying of metal ions effects on plant cells and whole plants are still topical. Early somatic embryos (ESEs) of spruce represent the unique plant model system, which can be used to study of various types of environmental stresses including metal ions under well controlled experimental conditions. In the paper nuclear magnetic resonance (NMR) and electrochemical techniques were employed to investigate the effect of cadmium(II) ions (0, 50, 150, 250, 500 and 1,000 µM) on early somatic embryos (ESEs) of Norway spruce, clone 2/32. The ESEs were treated with cadmium(II) ions for fourteen days. The increase in cluster area and viability were determined by image analysis and fluorescein diacetate/propidium iodide double staining, respectively. Growth characteristics revealed the ESEs treated with cadmium-ethylene diamine tetra-acetic acid (Cd-EDTA) showed an increase in growth-inhibiting effect due to cadmium(II). Furthermore, total thiol content and certain low molecular mass plant thiols (cysteine, reduced glutathione, oxidized glutathione and phytochelatin2) were determined using Brdicka reaction and liquid chromatography with electrochemical detection, respectively. The highest level of phytochelatin2 synthesis was determined in ESEs treated with 50 µM Cd-EDTA. The average content of phytochelatin2 varied from 850 to 1800 nM/g FW. We also attempted to determine changes in water content in the ESEs treated with cadmium(II) ions using NMR. The highest increase in water content was observed at clusters treated with 250 µM Cd-EDTA. The clusters treated with higher cadmium concentrations (more than 250 µM) demonstrate only slow increase in the water content. Water metabolism at woody plants and their embryos exposed to cadmium(II) ions has not yet been described. Based on the results obtained it can conclude that the cells of embryonic clusters attempted to excrete cadmium(II) ions or, more precisely, decrease its

99

Int. J. Electrochem. Sci., Vol. 5, 2010

1536

concentration within the cluster. This phenomenon can be considered as one of the detoxification mechanisms of plants use to deal with the presence of heavy metal contamination. The escalation of water uptake continuously progress as long as the thiols are synthesized.

Keywords: Plant; Norway Spruce, Somatic Embryos; Water; Thiol; Nuclear Magnetic Resonance; Voltammetry Abbreviations: CCD charge-coupled device; Cys cysteine; DPV differential pulse voltammetry; EDTA ethylene diamine tetra-acetic acid; ESE early somatic embryo; FDA fluorescein diacetate; GSH reduced glutathione; GSSG oxidised glutathione; HPLC high performance liquid chromatography; NMR nuclear magnetic resonance; PCs phytochelatins; PI propidium iodide

1. INTRODUCTION Nuclear magnetic resonance (NMR) spectroscopy is a non-invasive imaging tool used by many to study molecules [1,2]. Proton NMR, 1H, is a common application of nuclear magnetic resonance in NMR spectroscopy used today [3]. NMR spectroscopy measures the interaction of an oscillating radiofrequency electromagnetic field with a collection of nuclei immersed in a strong external magnetic field to study molecules [4]. While NMR is frequently used in medicine, it is also used in biological, biochemical and chemical research. In plant biology, NMR is utilized to study water and mineral compounds transported within a plant [5-12], the determination of plant metabolites [13-17], the investigation of cellular processes [18-20] and for examining the growth and development of plants [21-26]. NMR use also monitors water changes in early somatic embryos of spruce [27]. Early somatic embryos of spruce represent unique plant model systems used in investigating the influence of environmental stress on woody plant species [28-31]. Plants evolved protective mechanisms which enable them to control the levels of metal ions, both essential and toxic pollutants of the environment [32], in their system. Thiols such as glutathione and phytochelatins partake in plant stress response to heavy metals toxicity [33-36]. Moreover, thiols act as scavengers of reactive oxygen species, produced by heavy metals [37]. To investigate the effect of cadmium(II) ions on ESEs, six concentrations of cadmium(II) ions (50, 100, 150, 250, 500 and 1,000 µM) were chosen and compared with untreated, controlled ESEs. Natural cadmium(II) concentrations in water is below the indicated levels, however its ion content in soil can be greater then 1 mg/kg [38]. Based on previously published results [27,29] ESEs are highly resistant to the presence of heavy metals. Therefore a wide range of cadmium(II) concentrations including 1,000 µM were utilized to study morphological changes within a short period of time. Nuclear magnetic resonance was employed to investigate the effects of cadmium(II) ions on ESEs. Additionally, the level of protective thiols in treated embryos was determined using electrochemical techniques.

100

Int. J. Electrochem. Sci., Vol. 5, 2010

1537

2. MATERIAL AND METHODS 2.1. Chemicals and pH measurements Phytochelatin2 (PC2, (γ-Glu-Cys)2-Gly was synthesized in Clonestar Biotech (Brno, Czech Republic) with a purity above 90%. HPLC-grade methanol (>99.9%; v/v) from Merck (Dortmund, Germany) was used. Fluorescein diacetate (FDA), propidium iodide (PI) and all other used reagents of ACS purity were purchased from Sigma Aldrich (Sigma Aldrich Chemical Corp.,USA) unless noted otherwise. All solutions were prepared using deionised water (18.2 MΩ, Millipore, France). Culture media were prepared using plant cell culture chemicals purchased from Duchefa Biochemie BV (Haarlem, The Netherlands). Pipettes, tips and micro test tubes were purchased from Eppendorf (Hamburg, Germany). The pH value was measured using WTW inoLab Level 3 with terminal Level 3 (Weilheim, Germany), controlled by the personal computer program (MultiLab Pilot; Weilheim, Germany). The pH-electrode (SenTix-H, pH 0 – 14/3 mol/dm3 KCl) was calibrated by set of WTW buffers (Weilheim, Germany). 2.2. Plant material and cultivation conditions Early somatic embryos (ESEs) of the Norway spruce (Picea abies /L./ Karst.), clone 2/32 from the collection of the Department of Plant Biology of Mendel University in Brno, was used. The embryonic culture was maintained on a semisolid (half-strength LP medium Gelrite Gellan Gum, Merck, Germany) with modifications in accordance with Havel and Durzan [39]. The concentration of 2,4-dichlorofenoxyacetic acid and N6-benzyladenine was 4.4 and 9 µM, respectively [40]. The pH value was adjusted to 5.7-5.8 before autoclaving (121°C, 100 kPa, 20 min). The organic part of the medium, excluding saccharose, was sterilized by ultrafiltration through a 0.2 µm polyethylensulfone membrane (Whatman, Puradisc 25 AS). Sub-cultivations of stock cultures were carried out at two week intervals. The stock and experimental cultures were maintained in a cultivation box in the dark at 23±2°C. The clusters of embryos were cultivated on the semisolid medium without cadmium(II) addition for 14 days and then transferred onto cultivation medium with an addition of cadmium(II) chelate (Cd-ethylene diamine tetra-acetic acid) at concentrations of 0 (only EDTA without Cd(II) ions), 50, 150, 250, 500 and 1,000 µM. A stock solution of Cd-EDTA was prepared by mixing Cd(NO3)2 with ethylene diamine tetra-acetic acid (EDTA) in a 1:1 molar ratio and stirred at 50°C for 1 h. The filter-sterilized Cd-EDTA complex was added to the autoclaved culture medium [41]. The samples were collected at the very beginning of the experiment and at 3rd, 6th, 8th, 10th and 14th day of the treatment. All experiments were carried in triplicates. 2.3. Computer image analysis We used a charge-coupled device (CCD) camera for the observation of growth of spruce ESEs. The images of ESEs clusters were recorded at the beginning of the treatment and in certain intervals according to the end of the treatment. The data were converted to a digital image in the Grab–IT (version 1.3) program. The area size of ESEs clusters in digital images was calculated by program

101

Int. J. Electrochem. Sci., Vol. 5, 2010

1538

Image–Pro Plus, (Sony, ver. 1.3). The data were processed in Excel (Microsoft). For other details reported on IA see in Ref. [29]. 2.4. Photography of ESEs in bright field ESEs (about 0.1 mg) were collected by a scalpel and transferred onto microscopic slides. The ESEs was spread and superimposed by cover glass. The sample was then placed and examined under a microscope (Olympus AX 70, Japan). The images were forty times magnified by digital camera Olympus 4040 and converted to digital image in the Grab–IT (version 1.3) program. 2.5. Double staining Modified double staining with FDA and PI for the determination of the viability of ESEs was used [29]. FDA causes green fluorescence in viable cells because the non-fluorescent FDA easily penetrates into viable cells where it is hydrolyzed to a brightly fluorescent fluorescein (λexcitation= 490 nm and λemission = 514 nm) that does not diffuse out readily through the cytoplasmatic membrane. The red fluorescence of PI (λexcitation = 536 nm and λemission = 620 nm) in cells shows these cells are dead since this compound is unable to pass through the functional cytoplasmatic membrane. ESEs (~1 mg) were harvested and diluted with water with a final volume of 50 µl. The stock solutions of PI and FDA were added to a final concentration of 20 µg/mL and 1 µg/mL respectively. After 5 min of incubation at room temperature, the percentage of dead (red-stained cells) and viable cells (green-stained cells) were evaluated using an Olympus AX 70 fluorescence microscope with an Olympus cube U-MWU coupled with the digital camera. The percentage quantification of red (dead cells) and green areas (viable cells) in compact embryonic group of single embryos were determined using method IA (Image–Pro Plus was used, ver. 1.3, Sony). 2.6. Electrochemical determination of total thiols content Electrochemical measurements were performed with 747 VA Stand instrument connected to 746 VA Trace Analyzer and 695 Autosampler (Metrohm, Switzerland), using a standard cell with three electrodes and cooled sample holder (4 °C). A hanging mercury drop electrode (HMDE) with a drop area of 0.4 mm2 was the working electrode. An Ag/AgCl/3M KCl electrode was the reference and glassy carbon electrode was auxiliary electrode. The supporting electrolyte (1 mM [Co(NH3)6]Cl3 and 1 M ammonium buffer; NH3(aq) and NH4Cl, pH 9.6) was changed after five measurements. The DPV parameters were as follows: sample volume 1 µl, supporting electrolyte volume 1.9 ml, time of accumulation 120 s, initial potential of –0.7 V, end potential of –1.75 V, modulation time 0.057 s, time interval 0.2 s, step potential 2 mV, modulation amplitude -250 mV, Eads = 0 V. All experiments were carried out at temperature 4 °C (Julabo F12, Germany). For smoothing and baseline correction the software GPES 4.9 supplied by EcoChemie was employed. The optimization of the experimental conditions was published by [42]. ESEs samples were prepared according to procedure published in [27]. Briefly, ESEs (~100 mg) were harvested and diluted with 0.066 M phosphate buffer (pH 7.0) with a final volume of

102

Int. J. Electrochem. Sci., Vol. 5, 2010

1539

1,000 µl. The mixture was prepared by hand-operated homogenizer ULTRA-TURRAX T8 (IKA, Germany) at 25,000 rpm for 3 minutes. The homogenate was transferred to a new test-tube. The mixture was further homogenised on a Vortex–2 Genie (Scientific Industries, New York, USA) at 4 °C for 30 min. The homogenate was centrifuged (14 000 g) for 30 min at 4 °C using a Universal 32 R centrifuge (Hettich-Zentrifugen GmbH, Tuttlingen, Germany). Prior to analysis the supernatant was filtered through a membrane filter (0.45 µm Nylon filter disk, Millipore, Billerica, Mass., USA). 2.7. Nuclear magnetic resonance Tomography working on magnetic resonance-base was used to study of the changes of H nucleus spin density in treated ESEs. Experiments were performed on a home-built MR imaging system equipped with a 4.7 T horizontal bore magnet with a bore diameter of 20 cm, operating at 200 MHz for 1H built at Institute of Scientific Instruments, Academy of Sciences of the Czech Republic, Brno, Czech Republic. Current active shielding gradient coils providing up to 180 mT/m gradient strength. Measuring samples were cultivated in plastic Petri dish (50 mm in diameter). The MR images were acquired using a classic Spin Echo pulse sequence with the following parameters: echo time (TE) = 12 ms, repetition time (TR) = 3.8 s, matrix size = 256 × 256 pixels (30 × 30 mm with resolution 0.117 mm per pixel), slice thickness = 2 mm and number of averages of the MR signal was (NA) = 5. The data were processed in Marevisi program. 1

2.8. High performance liquid chromatography with electrochemical detection High performance liquid chromatography with electrochemical detection (HPLC-ED) system consisted of two chromatographic pumps Model 582 ESA (working range 0.001-9.999 ml.min-1, ESA Inc., Chelmsford, MA), reverse-phase chromatographic column Polaris C18A (150 × 4,6; 3 µm particles size, Varian Inc., CA, USA) and twelve-channel CoulArray electrochemical detector (Model 5600A, ESA, USA). The electrochemical detector includes three flow cells (Model 6210, ESA, USA). Each cell consists of four analytical cells containing working carbon porous electrode, two auxiliary and two reference electrodes. The samples were injected by autosampler (Model 542, ESA, USA) at 4 °C. The injected sample volume was 50 µl. HPLC-ED experimental conditions were as follows: mobile phase: 80 mmol.l-1 trifluoroacetic acid (solvent A) and methanol (solvent B); gradient: 3 % methanol constant for 8 minutes, then increase of methanol to 15 % during 1 min, after 8 minutes of constant methanol content (15 %) decrease to 3 % during 1 min; mobile phase flow rate 0.8 ml.min-1, column and detector were thermostated at 25 °C, the potential set on working electrodes was 900 mV. The optimization of the experimental conditions for the separation and detection of the thiols was published by [43-46]. The samples were processed same as in Subchapter 2.6. 2.9. Statistical analysis Data were processed using MICROSOFT EXCEL® (USA) and STATISTICA.CZ Version 8.0 (Czech Republic). Results are expressed as mean ± standard deviation (S.D.) unless noted otherwise (EXCEL®). Statistical significances of the differences in single and total thiols content and water

103

Int. J. Electrochem. Sci., Vol. 5, 2010

1540

content were determined using STATISTICA.CZ. Differences with p < 0.05 were considered significant and were determined by using of one way ANOVA test (particularly Scheffe test), which was applied for means comparison.

3. RESULTS AND DISCUSSION 3.1. Growth and viability of ESEs Early somatic embryos of Norway spruce, clone 2/32, were cultivated on semisolid LP cultivation medium, where the embryonic cells formed clusters (inset in Fig. 1). The growth parameters of the clusters can be determined using computer image analysis as a non-destructive tool. Each cluster is scanned using a CCD camera. The scanned image is further transferred to the computer, where the acquired image is subsequently analysed and the area of cluster is determined [29]. The control clusters of ESEs, clone 2/32, grew well during the fourteen days of cultivation (y = 18.151x 8.1976; R2 = 0.9929, Fig. 1). The viability of the control ESEs determined using double staining method varied from 94.5 % to 99.5 % (97±2.5%). These viability parameters are the same as previously published [27,29,30,47]. The growth and viability characteristics of clone 2/32 determined in the present paper show the stability of the ESEs culture, which make it useful for the investigation of the influence of various types of environmental stress factors.

Figure 1. The dependence of increase in the ESEs clusters area on time of the treatment of ESEs by Cd-EDTA (0, 50, 150, 250, 500 and 1,000 µM Cd-EDTA). In inset: the typical images of the clusters at various times of the treatment (0th, 3rd, 6th, 8th, 10th and 14th day).

104

Int. J. Electrochem. Sci., Vol. 5, 2010

1541

Cadmium(II) ions were applied in the chelated form since cadmium(II) inorganic salts precipitate out with other components of the cultivation medium which cannot be taken up by a plant cell [41]. The obtained growth characteristics of the ESEs treated with Cd-EDTA showed growthinhibiting effect of cadmium(II) well determined by decrease in the cluster area (Fig. 1). At the end of the treatment, the inhibition could be quantified as the decrease in ESEs cluster area (DCA) about 0.5 % per 1 µM of Cd-EDTA compared with control ESEs (Fig. 1). The figure was calculated according to following equation: ∑ DCA =

increase in cluster areacontrol ESEs − increase in cluster area ESEs treated with cadmium( II ) ions cadmium( II ) dose n

where: n – number experimental groups excluding control, both increases in cluster area are measured at 14th day of the treatment. Moreover, higher concentrations of Cd-EDTA resulted in significant morphological changes and decrease in viability of the embryonic cells (Fig. 2). The viability of the embryonic cells treated with the highest cadmium concentration (1,000 µM Cd-EDTA) decreased 47 ± 5 % at the end of the experiment. Karcz and Kurtyka investigated the effect of cadmium(II) ions on growth, proton extrusion and membrane potential in maize coleoptile segments [48]. They used similar concentrations of the heavy metal ions (0, 0.1, 1, 10, 100 and 1,000 µM). They also observed growth depression at concentrations higher than 100 µM, which is in good agreement with the present results. The cadmium(II) ions induced growth inhibition at almond seedlings [49], green microalga Scenedesmus armatus (Chod.) [50] and others.

Figure 2. Changes in the viability and morphology of the somatic embryos cultivated in the presence of 0, 50, 250 and 500 µM Cd-EDTA at 3rd day of the treatment studied using FDA/PI double staining. FDA causes green fluorescence in viable cells. The red fluorescence of PI in cells shows that these cells are dead.

105

Int. J. Electrochem. Sci., Vol. 5, 2010

1542

3.2. Total thiols content in ESEs Based on the results obtained here and published previously [27] ESEs of Norway spruce, clone 2/32, demonstrate great resistance to complex Cd-EDTA. It is likely that synthesis of protective thiols involved in heavy metal induced stress reaction of a plant cell could closely be associated with this phenomenon. The electrochemical techniques such as differential pulse voltammetry (DPV) Brdicka reaction is a suitable tool for the analysis of thiols [33,41]. Peptides and proteins rich in free —SH group give specific catalytic signals in the presence of Co(III) complex and ammonium buffer called Brdicka reaction. One of these catalytic signals called Cat2 is proportional to thiols concentration and, thus, can be utilized for quantification of these molecules [28,42,51-54]. The typical DP voltammograms of the clusters of ESEs treated with 500 µM Cd-EDTA collected at 0th, 10th and 14th day of the treatment are shown in inset in Fig. 3. The enhancing height of the Cat2 peaks with increasing time of the treatment is well evident. The differences between total content of thiols expressed as the enhancement of Cat2 peak in control and treated ESEs are shown in Fig. 3. It clearly follows from the results obtained that the content of thiols in the treated ESEs were lower compared to control ESEs at 3rd day of the treatment. This phenomenon probably indicates the depletion of free thiols due to the binding of cadmium(II) ions entering plant cells as well as insufficient biosynthesis of the new thiols in the treated ESEs. At the sixth day of the treatment, the biosynthesis of thiols enhanced. Their increasing content was proportional to cadmium(II) concentrations and time of the treatment till the end of the experiment (Fig. 3). The rapid increase in thiol levels in the treated ESEs demonstrates their ability to withstand heavy metal toxicity over a long period of time (Fig. 1).

3.3. Content of low molecular plant thiols in ESEs In spite of the fact that stationary electrochemical methods are commonly used for detection of numerous biologically active compounds [55-73], DPV Brdicka reaction cannot facilitate the exact identification of individual thiols [74]. Thiols (cysteine Cys, reduced glutathione GSH, oxidized glutathione GSSG and phytochelatin 2 PC2) involved in plant heavy metals detoxification processes were quantitatively determined using high performance liquid chromatography with electrochemical detection (HPLC-ED). HPLC-ED chromatogram of the thiols standards (Cys, GSH, GSSG and PC2, 1 µM) is shown in Fig. 4A. The HPLC-ED chromatograms of the samples prepared from the ESEs treated with 500 µM Cd-EDTA collected at 0th, 10th and 14th day of the treatment are shown in Fig. 4B. The chromatograms obtained were repeatable. The peaks of the thiols were well separated and developed. The content of cysteine, one of the simplest thiols, increased up to the eighth day of the treatment, after that its content slowly decreased. This can be associated with the use of cysteine in biosynthetic pathways for phytochelatin and glutathione synthesis (Fig. 5A). In the case of GSH its content in the ESEs gradually enhanced with higher cadmium concentration and time of the treatment up to the sixth day of treatment (Fig. 5B). Similar trends in GSH content were determined in the cadmium hyperaccumulator Sedum alfredii Hance [75]. From this day on, the levels of GSH in ESEs exposed to Cd-EDTA were approximately well-balanced (within the range from 190 to 400 µM/g FW). GSSG level was significantly lower in all analysed samples (within the range from 10 to 35

106

Int. J. Electrochem. Sci., Vol. 5, 2010

1543

µM/g FW). Moreover, the decreasing trend in GSSG content in ESEs exposed to Cd-EDTA was observed. This indicates the capability of the Norway spruce somatic embryos to bind heavy metals ions and thereby scavenge free oxygen radicals (Fig. 5C). Moreover Mendoza-Cozati and MorenoSanchez suggested a kinetic model of GSH and phytochelatin synthesis, which discussed the depletion of glutathione via synthesis of phytochelatins [76].

Figure 3. The changes in the total thiols content in ESEs treated with 0, 50, 150, 250, 500 and 1,000 µM Cd-EDTA. The total content of the thiols determined in the control samples was subtracted. In inset: typical DP voltammograms of the ESEs treated with 500 µM of Cd-EDTA at 0 th, 10 th and 14th day of the treatment. Measurements were carried out using DPV Brdicka reaction. For the measurements three clusters from three replicates were used. Changes in thiol content are expressed as percent differences from controls cultivated on Cd-free medium. The data measured were subtracted from this value.

In the case of the most important plant peptide involved in heavy metal detoxification processes called phytochelatin (PC2), its lowest concentration was determined at the third as well as at the sixth day of treatment. Based on the results obtained, it can be concluded the adaptation mechanisms of plant cells and PC2 synthesis were not sufficient to cover the total requirements of early somatic embryos to survive stress due to the presence of heavy metal ions. Applying cadmium ions after the sixth day, the biosynthesis of PC2 rapidly and significantly increased depending on time of the treatment as well as CD-EDTA concentration (Fig. 5D). The most intensive PC2 synthesis was determined in ESEs treated with 50 µM Cd-EDTA. Under effects of higher concentrations of Cd-EDTA, the content of PC2 was lower which can be associated with reducing the number of living cells. The average content of PC2 varied from 850 to 1800 nM/g FW in the ESEs. The content of PC2 is in good agreement with the levels determined at Bacopa monnieri L. treated with cadmium(II) ions

107

Int. J. Electrochem. Sci., Vol. 5, 2010

1544

[77] The content of PC2 determined the ESEs is higher than the content detected in in vitro culture of the red spruce [78].

Figure 4. Typical HPLC-ED chromatograms of (A) Cys, GSH, GSSG and PC2 standards (1 µM) and (B) of real samples at 0th , 10th and 14th day of the clusters treatment with 500 µM Cd-EDTA. There can be recognized signals of all four thiols of interest according to their retention times found in standard chromatogram.

Figure 5. The changes of the low molecular plant thiols content. The content of (A) Cys, (B) GSH, (C) GSSG and (D) PC2 in the ESEs clusters treated with 0, 50, 150, 250, 500 and 1,000 µM Cd-EDTA. The thiols content detected in the control ESEs was subtracted. The resulting content was re-calculated on 1 gram of fresh weight of the cluster. Changes in thiol content are expressed as percent differences from controls cultivated on Cd-free medium. The data measured were subtracted from this value.

108

Int. J. Electrochem. Sci., Vol. 5, 2010

1545

3.4. Nuclear magnetic resonance Water content in the ESEs was studied using NMR. Brightness of the pixel image corresponded to the number of nuclei at the designated place. Therefore changes in number of proton nuclei (water content) during the cultivation of ESEs could be determined. As a control of the measuring system’s sensitivity, the cuvette filled with water was placed near the measured cultures. The obtained images were standardized on the constant magnitude of the cuvette visual slice. The colour scale showing both water and dry weight content in the ESEs was estimated. Clusters of ESEs were placed on a Petri dish containing cultivation medium with various concentrations of Cd-EDTA. The whole Petri dish was put in the working space of a NMR scanner; five clusters were monitored in one scan. Typical NMR image of the individual clusters is shown in Fig. 6. Blue colour indicates the presence of water in the clusters, yellow and red tones show the decrease in the water content.

Figure 6. NMR scans of the ESEs clusters treated with 0, 50, 150, 250, 500 and 1,000 µM Cd-EDTA in time scale of the treatment. The data given in Fig. 6 provided very interesting findings on water accumulation in the clusters of ESEs treated with higher Cd-EDTA concentrations. Marevisi computer program were employed to determine these changes. The changes indicated water content in the ESEs markedly oscillates during the first days of treatment. These oscillations did not depend on the cadmium concentration as well as the time of the treatment (Fig. 7). Over time the water content in the clusters significantly enhanced according to Cd-EDTA concentrations and the time of the treatment. The highest water content was observed at 10th day of the treatment (Fig. 7). The average content of water

109

Int. J. Electrochem. Sci., Vol. 5, 2010

1546

in the ESEs clusters treated by various cadmium concentrations compared to control clusters is shown in Fig.7. It clearly follows from obtained results the highest increase in water content was observed at the clusters treated with 250 µM Cd-EDTA. The clusters treated with higher cadmium(II) ions concentrations demonstrate lower increase in water content. The affect of water metabolism by cadmium(II) ions has not been intensively investigated. Milone et al. showed cadmium(II) ions did not cause changes in relative water content in wheat treated with cadmium(II) ions [79]. Devi et al. reported 50 µM of cadmium(II) ions induced water loss content in shoots and roots at the treated pea [80]. Similar results were described by past studies [81,82].

Figure 7. The average water contents in the ESEs clusters treated with Cd-EDTA. In inset: the dependence of the water content on the Cd-EDTA concentration and the time of the treatment. The water content was evaluated using computer program Marevisi.

4. CONCLUSIONS Water metabolism at woody plants and their somatic embryos exposed to cadmium(II) ions has not yet been described. Based on the results obtained it can conclude that the cells of ESE clusters attempted to excrete cadmium(II) ions or, more precisely, decrease its concentration within the cluster. Previous observations indicate cadmium(II) treated plants transported toxic ions to older leaves [33]. However in order to lower cadmium concentration inside a cluster water uptake was seen to increase.

110

Int. J. Electrochem. Sci., Vol. 5, 2010

1547

This phenomenon can be considered as one of the detoxification mechanisms of plants use to deal with the presence of heavy metal contamination. The escalation of water uptake continuously progress as long as the thiols are synthesized. These mechanisms provide the Norway spruce embryonic culture to survive against unfavourable conditions in the presence of heavy metal concentrations.

ACKNOWLEDGEMENTS The authors wish to express their thanks to Dr. Grace J. Chavis for language corrections and discussions. The financial support from the following projects GA CR 522/07/0692, 102/08/1546 and 204/09/H002, 1M06030, AV0 Z20650511 and MSMT 6215712402 is greatly acknowledged.

References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25.

D. J. Cosgrove, Plant Physiol. Biochem., 38 (2000) 109. H. K. Kim, Y. H. Choi and R. Verpoorte, Nat. Protoc., 5 (2010) 536. K. Ilvonen, L. Palva, M. Peramaki, R. Joensuu and R. Sepponen, J. Magn. Reson., 149 (2001) 36. R. S. Macomber, A Complete Introduction to Modern NMR Spectroscopy, John Wiley & Sons, Inc., New York, 1998. M. J. Clearwater and C. J. Clark, Plant Cell Environ., 26 (2003) 1205. A. G. Perez-Donoso, L. C. Greve, J. H. Walton, K. A. Shackel and J. M. Labavitch, Plant Physiol., 143 (2007) 1024. T. W. J. Scheenen, F. J. Vergeldt, A. M. Heemskerk and H. Van As, Plant Physiol., 144 (2007) 1157. H. Van As, J. Exp. Bot., 58 (2007) 743. A. Van der Toorn, H. Zemah, H. Van As, P. Bendel and R. Kamenetsky, J. Exp. Bot., 51 (2000) 1277. L. Van der Weerd, M. Claessens, C. Efde and H. Van As, Plant Cell Environ., 25 (2002) 1539. C. W. Windt, F. J. Vergeldt, P. A. De Jager and H. Van As, Plant Cell Environ., 29 (2006) 1715. I. F. Ionenko, A. V. Anisimov and N. R. Dautova, Biol. Plant., 54 (2010) 488. J. A. Heyes and C. J. Clark, Funct. Plant Biol., 30 (2003) 1089. B. L. Tan, N. Reddy, V. Sarafis, G. A. C. Beattie and R. Spooner-Hart, Hortscience, 40 (2005) 720. T. Y. Tse, R. M. Spanswick and L. W. Jelinski, Protoplasma, 194 (1996) 54. Y. Q. Pu, F. Chen, A. Ziebell, B. H. Davison and A. J. Ragauskas, BioEnergy Res., 2 (2009) 198. K. G. Zulak, A. M. Weljie, H. J. Vogel and P. J. Facchini, BMC Plant Biol., 8 (2008) 19. P. V. Gersbach and N. Reddy, Ann. Bot., 90 (2002) 253. J. Lambert, P. Lampen, A. von Bohlen and R. Hergenroder, Anal. Bioanal. Chem., 384 (2006) 231. M. Stark, B. Manz, A. Ehlers, M. Kueppers, I. Riemann, F. Volke, U. Siebert, W. Weschke and K. Konig, Microsc. Res. Tech., 70 (2007) 426. S. M. Glidewell, M. Moller, G. Duncan, R. R. Mill, D. Masson and B. Williamson, New Phytol., 154 (2002) 197. N. R. Jagannathan, R. Jayasundar, V. Govindaraju and P. Raghunathan, Proc. Indian Acad. Sci.Chem. Sci., 106 (1994) 1595. J. L. Maas and M. J. Line, Hortscience, 30 (1995) 1090. M. I. Menzel, A. M. Oros-Peusquens, A. Pohlmeler, N. J. Shah, U. Schurr and H. U. Schneider, J. Plant Nutr. Soil Sci.-Z. Pflanzenernahr. Bodenkd., 170 (2007) 24. M. M. Millard, O. B. Veisz, D. T. Krizek and M. Line, Plant Cell Environ., 18 (1995) 535.

111

Int. J. Electrochem. Sci., Vol. 5, 2010

1548

26. J. A. Vozzo, J. M. Halloin, T. G. Cooper and E. J. Potchen, Seed Sci. Technol., 24 (1996) 457. 27. V. Supalkova, J. Petrek, J. Baloun, V. Adam, K. Bartusek, L. Trnkova, M. Beklova, V. Diopan, L. Havel and R. Kizek, Sensors, 7 (2007) 743. 28. R. Mikelova, J. Baloun, J. Petrlova, V. Adam, L. Havel, H. Petrek, A. Horna and R. Kizek, Bioelectrochemistry, 70 (2007) 508. 29. J. Petrek, J. Vitecek, H. Vlasinova, R. Kizek, K. J. Kramer, V. Adam, B. Klejdus and L. Havel, Anal. Bioanal. Chem., 383 (2005) 576. 30. J. Vitecek, V. Adam, J. Petrek, J. Vacek, R. Kizek and L. Havel, Plant Cell Tissue Organ Cult., 79 (2004) 195. 31. M. F. Belmonte, G. Donald, D. M. Reid, E. C. Yeung and C. Stasolla, J. Exp. Bot., 56 (2005) 2355. 32. E. Grill, E. L. Winnacker and M. H. Zenk, Science, 230 (1985) 674. 33. V. Supalkova, D. Huska, V. Diopan, P. Hanustiak, O. Zitka, K. Stejskal, J. Baloun, J. Pikula, L. Havel, J. Zehnalek, V. Adam, L. Trnkova, M. Beklova and R. Kizek, Sensors, 7 (2007) 932. 34. C. Cobbett and P. Goldsbrough, Annu. Rev. Plant Biol., 53 (2002) 159. 35. A. Meister and M. E. Anderson, Annu. Rev. Biochem., 52 (1983) 711. 36. P. Babula, V. Adam, R. Opatrilova, J. Zehnalek, L. Havel and R. Kizek, Environ. Chem. Lett., 6 (2008) 189. 37. C. K. Sen and L. Packer, Faseb J., 10 (1996) 709. 38. M. B. Kirkham, Geoderma, 137 (2006) 19. 39. L. Havel and D. J. Durzan, Int. J. Plant Sci., 157 (1996) 8. 40. H. Vlasinova, M. Mikulecky and L. Havel, Biol. Plant., 47 (2003) 475. 41. J. Vacek, J. Petrek, R. Kizek, L. Havel, B. Klejdus, L. Trnkova and F. Jelen, Bioelectrochemistry, 63 (2004) 347. 42. J. Petrlova, D. Potesil, R. Mikelova, O. Blastik, V. Adam, L. Trnkova, F. Jelen, R. Prusa, J. Kukacka and R. Kizek, Electrochim. Acta, 51 (2006) 5112. 43. J. Petrlova, R. Mikelova, K. Stejskal, A. Kleckerova, O. Zitka, J. Petrek, L. Havel, J. Zehnalek, V. Adam, L. Trnkova and R. Kizek, J. Sep. Sci., 29 (2006) 1166. 44. D. Potesil, J. Petrlova, V. Adam, J. Vacek, B. Klejdus, J. Zehnalek, L. Trnkova, L. Havel and R. Kizek, J. Chromatogr. A, 1084 (2005) 134. 45. V. Diopan, K. Stejskal, M. Galiova, V. Adam, J. Kaiser, A. Horna, K. Novotny, M. Liska, L. Havel, J. Zehnalek and R. Kizek, Electroanalysis, 22 (2010) 1248. 46. O. Zitka, D. Huska, V. Adam, A. Horna, M. Beklova, Z. Svobodova and R. Kizek, Int. J. Electrochem. Sci., 5 (2010) 1082. 47. J. Vitecek, V. Adam, J. Petrek, P. Babula, P. Novotna, R. Kizek and L. Havel, Chem. Listy, 99 (2005) 496. 48. W. Karcz and R. Kurtyka, Biol. Plant., 51 (2007) 713. 49. E. Nada, B. A. Ferjani, R. Ali, B. R. Bechir, M. Imed and B. Makki, Acta Physiol. Plant., 29 (2007) 57. 50. Z. Tukaj, A. Bascik-Remisiewicz, T. Skowronski and C. Tukaj, Environ. Exp. Bot., 60 (2007) 291. 51. V. Adam, O. Blastik, S. Krizkova, P. Lubal, J. Kukacka, R. Prusa and R. Kizek, Chem. Listy, 102 (2008) 51. 52. R. Kizek, J. Vacek, L. Trnkova, B. Klejdus and L. Havel, Chem. Listy, 98 (2004) 166. 53. J. Kukacka, J. Petrlova, R. Prusa, V. Adam, B. Sures, M. Beklova, L. Havel and R. Kizek, Faseb J., 20 (2006) A75. 54. L. Trnkova, R. Kizek and J. Vacek, Bioelectrochemistry, 56 (2002) 57. 55. P. Daneshgar, P. Norouzi, M. R. Ganjali and F. Dousty, Int. J. Electrochem. Sci., 4 (2009) 444. 56. A. A. Ensafi, M. Taei and T. Khayamian, Int. J. Electrochem. Sci., 5 (2010) 116. 57. J. R. Esch, J. R. Friend and J. K. Kariuki, Int. J. Electrochem. Sci., 5 (2010) 1464.

112

Int. J. Electrochem. Sci., Vol. 5, 2010

1549

58. O. A. Farghaly, O. A. Hazzazi, E. M. Rabie and M. Khodari, Int. J. Electrochem. Sci., 3 (2008) 1055. 59. M. R. Ganjali, F. Faridbod, E. Nasli-Esfahani, B. Larijani, H. Rashedi and P. Norouzi, Int. J. Electrochem. Sci., 5 (2010) 1422. 60. J. G. Manjunatha, B. E. K. Swamy, G. P. Mamatha, S. S. Shankar, O. Gilbert, B. N. Chandrashekar and B. S. Sherigara, Int. J. Electrochem. Sci., 4 (2009) 1469. 61. P. Norouzi, F. Faridbod, B. Larijani and M. R. Ganjali, Int. J. Electrochem. Sci., 5 (2010) 1213. 62. P. Norouzi, M. Pirali-Hamedani, M. R. Ganjali and F. Faridbod, Int. J. Electrochem. Sci., 5 (2010) 1434. 63. P. Norouzi, M. Qomi, A. Nemati and M. R. Ganjali, Int. J. Electrochem. Sci., 4 (2009) 1248. 64. M. Ogunlesi, W. Okiei, A. S. Akanmu, T. Popoola, K. Okafor and O. Akore, Int. J. Electrochem. Sci., 4 (2009) 1593. 65. I. Fabrik, J. Kukacka, J. Baloun, I. Sotornik, V. Adam, R. Prusa, D. Vajtr, P. Babula and R. Kizek, Electroanalysis, 21 (2009) 650. 66. D. Huska, V. Adam, O. Zitka, J. Kukacka, R. Prusa and R. Kizek, Electroanalysis, 21 (2009) 536. 67. D. Huska, J. Hubalek, V. Adam, D. Vajtr, A. Horna, L. Trnkova, L. Havel and R. Kizek, Talanta, 79 (2009) 402. 68. S. Krizkova, P. Blahova, J. Nakielna, I. Fabrik, V. Adam, T. Eckschlager, M. Beklova, Z. Svobodova, V. Horak and R. Kizek, Electroanalysis, 21 (2009) 2575. 69. S. Krizkova, I. Fabrik, V. Adam, J. Kukacka, R. Prusa, L. Trnkova, J. Strnadel, V. Horak and R. Kizek, Electroanalysis, 21 (2009) 640. 70. V. Adam, D. Huska, J. Hubalek and R. Kizek, Microfluid. Nanofluid., 8 (2010) 329. 71. V. Adam, J. Petrlova, J. Wang, T. Eckschlager, L. Trnkova and R. Kizek, PLoS ONE, 5 (2010) e11441. 72. O. Krystofova, L. Trnkova, V. Adam, J. Zehnalek, J. Hubalek, P. Babula and R. Kizek, Sensors, 10 (2010) 5308. 73. J. Sochor, O. Zitka, H. Skutkova, D. Pavlik, P. Babula, B. Krska, A. Horna, V. Adam, I. Provaznik and R. Kizek, Molecules, 15 (2010) 6285. 74. V. Adam, I. Fabrik, V. Kohoutkova, P. Babula, J. Hubalek, R. Vrba, L. Trnkova and R. Kizek, Int. J. Electrochem. Sci., 5 (2010) 429. 75. Q. Sun, Z. H. Ye, X. R. Wang and M. H. Wong, J. Plant Physiol., 164 (2007) 1489. 76. D. G. Mendoza-Cozatl and R. Moreno-Sanchez, J. Theor. Biol., 238 (2006) 919. 77. S. Mishra, S. Srivastava, R. D. Tripathi, R. Govindarajan, S. V. Kuriakose and M. N. V. Prasad, Plant Physiol. Biochem., 44 (2006) 25. 78. P. Thangavel, S. Long and R. Minocha, Plant Cell Tissue Organ Cult., 88 (2007) 201. 79. M. T. Milone, C. Sgherri, H. Clijsters and F. Navari-Izzo, Environ. Exp. Bot., 50 (2003) 265. 80. R. Devi, N. Munjral, A. K. Gupta and N. Kaur, Environ. Exp. Bot., 61 (2007) 167. 81. J. Kovacik, J. Tomko, M. Backor and M. Repcak, Plant Growth Regul., 50 (2006) 239. 82. E. LozanoRodriguez, L. E. Hernandez, P. Bonay and R. O. CarpenaRuiz, J. Exp. Bot., 48 (1997) 123. © 2010 by ESG (www.electrochemsci.org)

113

5.3.2 Analýza vliv iontů kadmia na raná somatická embrya Smrku ztepilého pomocí elektrochemických technik a nukleární magnetické rezonance.

Studiem vlivu těţkých kovů na rostliny a hledáním nových analytických metod a postupů, nám umoţňuje posuzovat výběr a vhodnost rostlin pro fytoremediační techniky, které stále nabývají na naléhavosti jejich vyuţití. V tomto článku jsme sledovali vliv kademnatých iontů na raná somatická embrya (ESE) klon 2/32 smrku ztepilého pomocí analýzy obsahu celkových tiolových látek včetně konkrétních sloučenin fytochelatinu 2 (PC2), redukovaného i oxidovaného glutationu (GSH a GSSG) a cysteinu. Dále jsme se zaměřili na vliv kademnatých iontů na obsah vody v ESE pomocí nukleární magnetické rezonance (NMR), coţ u ESE doposud nebylo pomocí NMR studováno. U ESE byly stanoveny i růstové křivky a viabilita. Celý experiment byl postaven na kultivaci ESE na LP médiu s přídavkem Cd2+ navázaného na EDTA a bez přídavku Cd2+. Doba kultivace byla 14 dnů nejdříve na médiu bez Cd2+ a následně pokračovala dalších 14 dnů za přítomnosti Cd-EDTA v koncentracích 50, 150, 250, 500 a 1,000 μM. V intervalech 0, 3, 6, 8, 10 a 14 dnů byly prováděny analýzy. Pro charakterizaci růstu byla vyuţita nedestruktivní metoda pomocí CCD kamery a obraz následně počítačově zpracován. Kademnaté ionty měli podle očekávání inhibiční vliv na růst ESE. V konečné fázi působení Cd2+ iontů bylo pozorováno zmenšení plochy klastru o 0,5 % na 1 μM Cd-EDTA v porovnání s kontrolou navíc analýza ţivotaschopnosti buněk pomocí barvení buněk fluorescein diacetátem (FDA) a propidium-jodidem (PI) byly potvrzeny morfologické změny a vyšší úmrtnost buněk oproti kontrole. Viabilita buněk u nejvyšší koncentrace 1000 µM Cd-EDTA byla viabilita buněk o 50 % sníţena na rozdíl od buněk kontrolních. Analýza celkového množství tiolových látek Peptidy a proteiny bohaté na –SH skupiny poskytují specifické katalytické signály v přítomnosti kobaltitého komplexu a amonného pufru. Jeden z těchto signálů nazývaný CAT2 se zvyšuje i s rostoucí koncentrací tiolových látek v roztoku. Jednotlivé křivky znázorňují analyzované vzorky, které byly odebrány v 0, 10 a 14 dni kultivace za přítomnosti 500 μM Cd-EDTA. Tímto způsobem byly analyzovány všechny vzorky. Mnoţství celkových tiolových látek v ESE v prvních 3 dnech doby kultivace bylo aţ o

114

30 % niţší neţ ESE kontrolní. Pokles obsahu tiolových látek lze vysvětlit vyvázáním volných tiolových látek kademnatými ionty (čímţ jsme nebyli schopni zachytit signál – SH skupin) jako první obranný mechanizmus a přizpůsobení se na změněné podmínky. Nárůstu celkového mnoţství tiolových látek u všech sledovaných koncentrací jsme pozorovali v 6 dni, přičemţ se jejich obsah zvyšoval aţ do konce experimentu tedy do 14 dne. Výsledky naznačují, ţe po počátečním vyčerpání tiolových látek a přizpůsobení se novým podmínkám, nastává fáze intenzivní biosyntézy tiolových látek, jako jeden z hlavních obranných mechanizmů, na stále trvající stresové podmínky. V dalším kroku jsme se zaměřili na analýzu čtyř nízko molekulárních tiolových látek (cysteinu, oxidovaného a redukovaného glutationu a fytochelatinu 2). Mnoţství cysteinu se zvyšovalo do 8 dne u všech sledovaných koncentrací CD-EDTA po té obsah cysteinu ve vzorcích pozvolna klesal. Tento trend je pravděpodobně spojen s biosyntézou fytochelatinů a glutationu kde je základní sloţkou právě cystein. Mnoţství redukovaného glutationu (GSH) výrazně rostlo (převáţně u vyšších koncentrací 500 a 1000 µM Cd-EDTA) do 6 dne, poté toto navýšení přetrvávalo aţ do konce experimentu. Stejný efekt kademnatých iontů na GSH byl pozorován i u hyperakumulující rostliny Sedum Alfredi Hance. Mnoţství fytochelatinu (PC2) bylo nejniţší ve 3 a 6 dni experimentu. Pravdě podobně to souvisí s adaptačními mechanizmy na podmínky prostředí. Po 6 dnu byl však zaznamenán vysoký nárůst mnoţství PC2 a to hlavně u koncentrace Cd-EDTA 50 µM. Průměrné mnoţství PC2 se pohybovalo v rozmezí hodnot 850 – 1800 nM/g FW. U vzorků byl stanoven i obsah vody pomocí nukleární magnetické rezonance (NMR). Obsah vody je znázorněn barevnou škálou. Ţlutá a červená bez obsahu vody, zelená a světle modrá nízký obsah vody a modrá aţ tmavě modrá značí na přítomnost velkého mnoţství vody v ESE. Vyhodnocení získaných dat nám poskytlo velmi zajímavé výsledky. Obsah vody v ESE během prvních dnů výrazně kolísal, přičemţ koncentrace Cd-EDTA i doba jejich působení, se zdá být, na to neměla vliv. V dalších dnech se ale obsah vody v klastrech výrazně zvyšoval a to jak vlivem koncentrace CdEDTA tak i dobou působení. Pokud se podíváme na obrázek, jako na celek zjistíme, ţe nejvyšší obsah vody se vyskytuje v posledních dnech experimentu a to převáţně u vyšších koncentrací Cd-EDTA. Obsah vody u raných somatických embryí smrku

115

doposud nikdo nestudoval. Nicméně podle získaných dat můţeme usuzovat, ţe na změny v mnoţství vody v ESE má vliv Cd-EDTA. Jedním z vysvětlení, můţe být snaha buněk sníţit koncentraci Cd-EDTA pomocí zvýšeného příjmu vody a zmírnit tím jejich negativní důsledky. Tento proces můţeme povaţovat jako jeden z dalších moţných detoxifikačních mechanizmů a markérů stresu u rostlin způsobených kademnatými ionty.

116

5.4 Detekce a izolace nukleových kyselin 5.4.1 Vědecký článek III

Miniaturized electrochemical detector as a tool for detection of DNA amplified by PCR. Huska, D.; Hubalek, J.; Adam, V.; Kizek, R Electrophoresis 2008, 29 (24), 4964-4971. IF = 3.569

Podíl autora Húska D.: 50 % textové části práce a 100% experimentální práce

117

4964 Dalibor Huska1 Jaromir Hubalek2 Vojtech Adam1,3 Rene Kizek1 1

Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University of Agriculture and Forestry, Brno, Czech Republic 2 Department of Microelectronics, Faculty of Electrical Engineering and Communication, Brno University of Technology, Brno, Czech Republic 3 Department of Animal Nutrition and Forage Production, Faculty of Agronomy, Mendel University of Agriculture and Forestry, Brno, Czech Republic

Received July 10, 2008 Revised August 27, 2008 Accepted August 31, 2008

Electrophoresis 2008, 29, 4964–4971

Research Article

Miniaturized electrochemical detector as a tool for detection of DNA amplified by PCR This paper reports on the analysis of specific sequence of Phage Lambda DNA amplified by PCR. Agarose gel electrophoresis, gel electrophoresis on chip and stationary electrochemical instrument were employed for detection of amplicons obtained after 2, 4, 6, 8, 10, 15, 20, 25, 30 and 35 cycles. In the case of agarose gel electrophoresis the lowest detectable amount of DNA was obtained after 15 PCR cycles. Gel electrophoresis on chip offers higher sensitivity because the lowest detectable amount of amplicons by this technique was obtained after eight PCR cycles. Further we employed square wave voltammetry and various working electrodes (hanging mercury drop electrode, screen-printed carbon electrode and carbonnanotube-based screen-printed electrodes) to detect amplicons. Amplicons obtained even after two cycles were detectable at all electrodes. To improve the selectivity of electrochemical detection carbon nanoelectrodes were off-line coupled with gel electrophoresis. Into the agarose gel the electrodes were placed. Further the amplicons were loaded into agarose gel wells. DNA migrating to the detection place was electrochemically analyzed. Amplicons obtained after two cycles were detectable by this hyphenated technique. Keywords: Carbon nanotubes / DNA / Gel electrophoresis on chip / PCR / Voltammetry DOI 10.1002/elps.200800445

1 Introduction A technique called PCR, at which a DNA polymerase is used to amplify a piece of DNA by in vitro enzymatic replication [1], is widely used in many branches of science. Amplified DNA can be detected by using of various techniques. Gel electrophoresis is routinely used for the detection of DNA fragments but suffers from no automated analysis and low sensitivity. Advantages, disadvantages and pitfalls of this standard technique are reviewed by Muyzer and Smalla [2] and von Wintzingerode et al. [3]. For automated analysis of large sets of samples CE can be used [4]. CE can be coupled with various types of detectors such as UV—VIS, fluorescent, MS, electrochemical and others. CE and its application have been reviewed several times in the last 2 years [5–8]. CE coupled with PCR can be used in various fields such as forensic science [9], clinical diagnostics [10], DNA mismatch detection [11, 12], food control [13], etc. Moreover, there are other proposed methods and techniques for the analysis of target DNA sequences on chips [14]. Correspondence: Dr. Rene Kizek, Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University of Agriculture and Forestry, Zemedelska 1, CZ-613 00 Brno, Czech Republic E-mail: [email protected] Fax: 1420-5-4521-2044

This paper reports on the analysis of PCR-amplified DNA by using various techniques. We employ agarose gel electrophoresis, gel electrophoresis on chip (Experion System [15]) and stationary electrochemical instrument with various working electrodes (hanging mercury drop, carbon paste and carbon screen-printed electrodes) to detect DNA. Then we attempt to couple gel electrophoresis with carbonnanotube-based screen-printed electrodes.

2 Materials and methods 2.1 Chemicals, material and pH measurements All chemicals of ACS purity (chemicals meet the specifications of the American Chemical Society) were used and parafilm were purchased from Sigma Aldrich Chemical (Sigma-Aldrich, USA). Taq PCR Kit with controls was from New England Biolabs, USA. Deionized water underwent demineralization by reverse osmosis using the instrument Aqua Osmotic 02 (Aqua Osmotic, Tisnov, Czech Republic) and then it was subsequently purified using Millipore RG (Millipore, USA, 18 MO) – MiliQ water. The pH value was measured using WTW inoLab (Weilheim, Germany).

2.2 Stationary electrochemical measurements Abbreviations: AdTS, adsorptive transfer stripping; CV, cyclic voltammetry; HMDE, hanging mercury drop electrode; SWV, square wave voltammetry

& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Electrochemical measurements were performed with AUTOLAB PGS30 Analyzer (EcoChemie, the Netherlands) www.electrophoresis-journal.com

118

Microfluidics and Miniaturization

Electrophoresis 2008, 29, 4964–4971

connected to VA-Stand 663 (Metrohm, Switzerland), using a standard cell with three electrodes. A hanging mercury drop electrode (HMDE) with a drop area of 0.4 mm2 or a carbon screen-printed electrode was employed as the working electrode. An Ag/AgCl/3 M KCl electrode served as the reference electrode. Glassy carbon electrode was used as the auxiliary electrode. For smoothing and baseline correction the software GPES 4.9 supplied by EcoChemie was employed. Square wave voltammetric (SWV – square wave voltammetry) and/or cyclic voltammetric (CV – cyclic voltammetry) measurements were carried out in the presence of acetate buffer, pH 5.0. SWV parameters: potential step 5 mV; frequency 260 Hz (HMDE) or 50 Hz (carbon electrodes). CV parameters: scan rates 10, 20, 40 and 80 mV/s, potential step 5 mV and time of accumulation 120 s [16]. The analyzed samples were deoxygenated prior to measurements by purging with argon (99.999%), saturated with water for 120 s. All experiments were carried out at room temperature.

2.3 Agarose gel electrophoresis

4965

2 min, 35 cycles were kept at 941C for 15 s, at 551C for 15 s and at 721C for 45 s. Finally, it was kept at 721C for 5 min and kept at +41C. The amplicons were analyzed by agarose gel electrophoresis, Experion and electrochemistry.

2.6 Screen-printed carbon electrode preparation 2.6.1 Screen-printed carbon electrodes The sensor was fabricated by using a standard thick-film technology process with screen-printing semi automat (UL 1505A, TESLA, CZ) and firing oven (TFF51, BTU International, USA). The thick-film technology materials used for reference (Ag/AgCl), and auxiliary electrode (platinum) were polymer pastes (DuPont, Czech Republic). Conductive layer, dielectric layer and auxiliary electrode were cermet pastes (ESL ElectroScience, UK). All pastes were fired according to the producer’s recommendations described in datasheets. The reference electrode was calibrated against saturated Ag/AgCl electrode [17].

Agarose gel (1%) was prepared by boiling 1  Tris-acetate EDTA buffer (40 mM Tris-acetate and 1 mM EDTA) for 15 min in a pressure cooker. Then the gel was cooled to 501C and ethidium bromide was added (10 mL per 100 mL of the gel). Samples prepared with bromophenol blue were loaded onto a gel in 5 mL aliquots. The electrophoresis was run at 100 V for 60 min. The bands were visualized using gel projection system (Vilber-Lourmant, France).

2.6.2 Carbon-nanotube-based screen-printed electrodes

2.4 Experion system

3 Results and discussion

Analyses on an automated microfluidic Experion electrophoresis system (Bio-Rad, USA) were carried out according to the manufacturer’s instructions with supplied chemicals (Experion DNA 1 K analysis kit, Bio-Rad). After priming of the chip with gel and gel-staining solution in the diluted priming station sample, samples processed according to the manufacturer’s instructions (9 mL) were loaded into sample wells. The chip with loaded samples was shaken for 60 s on Vortex-2 Genie (Scientific Industries, USA). The chip was placed into the electrophoretic instrument and measurement was carried out.

In the last decade electrochemical instruments are used intensively for analysis of nucleic acids. The main trend in their usage is to miniaturize the detection system [18–28]. Coupling of separation and detection systems brings many advantages including much higher selectivity and sensitivity. Owing to very low amounts of biological samples, preconcentration or amplification techniques must precede own analysis. PCR belongs to the most commonly used method for amplification of DNA.

The carbon multiwalled nanotubes (Sigma-Aldrich) was mixed with organic binder based on terpineol (Heraeus, Germany) and homogenized in mortar for 15 min. Printing was done using a semi-automated screenprinter and dried at 1501C as described in Section 2.6.1.

3.1 PCR 2.5 PCR The master mix was prepared for Taq PCR according to the kit with controls purchased from New England BioLabs (USA). Lambda DNA template – primer (forward): 50 CCTGCTCTGCGCTTCACGC-30 ; (backward): 50 -TCCGGATAAAAACGTCGATGACATTTTGC-30 – was used, MgCl2 (2 mM), dNTP (10 mM), primers (10 pM), and Taq polymerase was introduced in 0.2 mL aliquots. Eppendorf tubes were placed into the thermal cycler (Eppendorf Mastercycler Gradient, Germany). After the denaturization at 951C for & 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Few DNA molecules isolated from a sample of interest cannot be analyzed without PCR. Many authors attempt to miniaturize PCR instruments [29–32]. Here, the concentration of template DNA was selected at such a low level, which was under detection limits of all tested instruments. Therefore, it had to be amplified by PCR. To ensure repeatability of DNA amplification, a simple amplification program was proposed. The PCR cycle was run according to the scheme shown in Fig. 1. One cycle consisted of standard steps such as initialization, denaturation, annealing and www.electrophoresis-journal.com

119

4966

Electrophoresis 2008, 29, 4964–4971

D. Huska et al.

Agarose gel electrophoresis

Polymerase chain reaction 100

Initial denaturation Denaturation

Temperature (˚C)

DNA samples

Gel electrophoresis on chip

75 Extension Pause

Electrochemistry

Annealing

50

Time (s)

30 sec Experimental cycle

Figure 1. Scheme of PCR coupled with various types of detection systems (agarose gel electrophoresis, gel electrophoresis on chip, electrochemistry).

extension. At the end of 2nd, 4th, 6th, 8th, 10th, 15th, 20th, 25th, 30th and 35th cycles the PCR program was stopped to get a sample for analysis. The amplicons obtained were analyzed by (i) agarose gel electrophoresis, (ii) gel electrophoresis on chip and/or (iii) electrochemistry (Fig. 1).

PCR cycle L 2

4

6

8 10 15 20 25 30 35 L

500 bp

3.2 Agarose gel electrophoresis Primarily the amplicons were detected on agarose gel in the presence of intercalating substance ethidium bromide. Typical gel of amplified part of Phage Lambda DNA is shown in Fig. 2. The lowest detectable amount of DNA was obtained after 15 PCR cycles. It follows from the results that we had to do more than 20 cycles to detect a specific sequence, which could be laborious and time consuming. Moreover, processing of the data obtained and their quantification could be difficult. On the other hand, good repeatability and reproducibility belong to the main advantages of this technique.

3.3 Gel electrophoresis on chip

Figure 2. Agarose (1%, 1  Tris-acetate EDTA buffer) gel of PCR products. DNA was stained by ethidium bromide (10 mL per 100 mL of the gel). Samples prepared with bromophenol blue were loaded onto a gel in 5 mL aliquots. Ladder (L) contains the following DNA fragments: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.5, 2, 3, 4, 5, 6, 8 and 10 kb. The experimental parameters were as follows: voltage 100 V, time 60 min.

Recently, gel electrophoresis on chip instrument called Experion was suggested to analyze DNA. Chip technology is suitable for detection of smaller nucleic acid fragments as PCR products. Therefore, we used this technique to detect

our amplicons. We expected enhancing of sensitivity of measurements. A typical record of analysis of a specific sequence of Phage Lambda DNA is shown in Fig. 3A.

& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.electrophoresis-journal.com

120

Microfluidics and Miniaturization

Electrophoresis 2008, 29, 4964–4971

A

Low molecular marker

High molecular marker

DNA

Fluorescence (mA.U)

1000

100 mAU

800 600 400 200 0 0

20 PCR cycle

40

PCR cycles

35 2

B

Ladder

20

40

60 80 Migration time (s)

100

120

PCR cycles 2

4

6

8

10

15

20

25

30

35

PCR DNA

Figure 3. Gel electrophoresis on chip. (A) Electrophoreograms of DNA amplified by PCR measured by Experion system; inset: height of fluorescence signal of amplified DNA. (B) Virtual gel of PCR products obtained after different numbers of cycles.

We used two molecular mass markers for lighter (migration time 42 s) and heavier fragments (migration time 84 s). Amplicons were detected in 63 s. The signals corresponding to amplicons were well separated and developed with good symmetry. Measurements were well repeatable with relative standard deviation as 5.6% (n 5 30). We found that the lowest detectable amount of amplicons was obtained after eight PCR cycles. The main increase in height of the signal corresponding to amplicons was determined from the 10th PCR cycle (inset in Fig. 3B). Because of Experion software we were able to make virtual gel (Fig. 3), where changes were also shown. The advantage of making a virtual gel is that we can compare more easily results obtained from standard gel electrophoresis and this instrument. Compared with standard agarose gel electrophoresis detection limit of gel electrophoresis on chip was almost two times lower. Therefore, this technique could be used in clinical diagnostics or forensic science.

3.4 Electrochemical detection of nucleic acids – mercury electrode Several papers dealing with electrochemical detection of the amplified DNA considering their potential uses for real-time & 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

4967

PCR were published recently [33, 34]. The electrochemical detection appears to have a potential to become a very sensitive analytical tool for nucleic acid analysis and also belongs to the most sensitive methods for detection of nucleic acids [35–37]. For this purpose different types of working electrodes (mercury or solid) can be used. Detection of nucleic acids at mercury electrodes was described by Professor Palec`ek more than 40 years ago [38]. Technical innovations, mathematical corrections and improvements of the detection technology allowed achieving a sensitive detection of nucleic acids using an HMDE. Moreover, to prevent interferences [39] and to enable analysis of very low volumes of a sample [40, 41], voltammetric methods can be coupled with adsorptive transfer stripping (AdTS) technique. The main improvement is based on electrode removal from a solution after accumulating of a target molecule on its surface, rinsing of the electrode and transferring to a pure supporting electrolyte, where no interferences are present (Fig. 4A). Typical AdTS cyclic voltammograms of amplified nucleic acids measured at various scan rates 10, 20, 40 and/or 80 mV/s are shown in Fig. 4B. The observed signals were well developed, symmetric and separated. The increasing of the sensitivity of the determination was reached by using SWV coupled with AdTS. The important parameter in adsorptive transfer technique is time of accumulation of the nucleic acid onto the electrode surface. To optimize this parameter we used amplicons obtained after 30 PCR cycles. The highest signal was measured after 60 s-long accumulation of the amplicons onto the surface of HMDE (Fig. 4C). The slight decrease in the analytical signal was observed with prolonged time of accumulation. This might be caused by the unorganized layer formation at the working electrode surface. We also tested accumulation dependences with lower concentration of amplicons. In that case enhancement of the signal with increasing time of accumulation was more distinct with maximum within the interval from 120 to 240 s (data not shown). This phenomenon relates with longer time needed to fully cover a surface of working electrode due to lower concentration of DNA in a solution. The proposed detection of the amplified DNA can also be used for quantification of amplified DNA. The electrochemical signal of the amplified DNA increased linearly to the 10th cycle (inset in Fig. 4D). From this point the observed signal increased exponentially. Moreover, the detection limit of the proposed procedure was lower compared with agarose gel or chip electrophoresis, because we were able to detect amplicons even from the second cycle (Fig. 4D). In spite of the fact that mercury electrode offers very high sensitivity to nucleic acids, mercury working electrode is not suitable for applications in automated detection systems because of the difficulty in handling the electrode due to their physico-chemical properties. Nevertheless, carbon electrodes have great potential to be miniaturized. www.electrophoresis-journal.com

121

4968

Electrophoresis 2008, 29, 4964–4971

D. Huska et al.

A working electrode

Scheme of adsorptive transfer stripping technique using HMDE as working electrode HMDE

Ag/AgCl

e

CE

transfer

a

b

measurement

transfer

washing

d

electrode modification

sample 5 µl

PC control

c transfer

B

D

100

1.6

10 mV/s

80

40 mV/s

scan

-1.3

-1.4

Potential (V)

C 100

Peak height (%)

80 mV/s

-1.2

Peak height (%)

Peak height (%)

20 mV/s

100 nA

60

1.2

0.8

0.4

0.0

40

5

0

10

PCR cycles

80 60

20

40 20

0 0

0 30

60

90

5

120 240 360

10

15 20 PCR cycles

Time of accumulation (s)

3.5 Electrochemical detection of nucleic acids – carbon electrode We focused on solid electrodes in the following experiment. Electrodes prepared by screen-printing or photolithography are suitable for automated detection systems [42, 43]. In our initial experiments the amplified DNA was measured at screen-printed electrodes with working carbon electrode. Low sample volume (3 mL) was introduced onto the surface of the carbon electrode. Further, nucleic acids were accumulated for 120 s. The electrode was rinsed in distilled water and placed into the measuring cell. At the end of a measurement, the electrode was washed in distilled water, dried, shortly sonicated and used for another measurement. This recycling of electrodes was done five times without any detectable decrease in the current response. Dependence of the peak height on the number of PCR cycles is shown in Fig. 5A. The current responses are not as high as those measured at HMDE. This may be caused by lower sensitivity of & 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

25

30

35

Figure 4. (A) The scheme of AdTS can be summarized in the following steps: (i) renewing of a surface of a working electrode; (ii) introducing of a sample on parafilm; (iii) adsorbing of a target molecule in a drop solution onto the surface at open circuit and/or superimposed potential; (iv) washing the working electrode in a solution; and (v) transferring of the washed electrode to a supporting electrolyte and measuring. (B) Typical cyclic voltammograms of PCR products. The following measurements were carried out by SWV. (C) Influence of time of accumulation of PCR products on the surface of HMDE on peak height. (D) Dependence of peak height on the number of PCR cycles (2–35 or 2–10 in the inset). Experimental parameters: working electrode HMDE. SWV parameters: potential step 5 mV, frequency 260 Hz. CV parameters: scan rates 10, 20, 40 and 80 mV/s, potential step 5 mV, time of accumulation 120 s. Peak height of 64 mA (C) and 232 mA ((D) and its inset) corresponds to 100%.

carbon electrodes compared with HMDE [44]. The change in signal height of amplicons obtained after 30 cycles with increasing time of accumulation is shown in the inset of Fig. 5A. The peak height increased gradually up to an accumulation time of 240 s, and then a slight decrease was determined. The sensitivity of DNA determination can be improved by using nanomaterials for electrode fabrication. We used carbon nanotubes with size from 80 to 200 nm for fabrication of working electrode of screen-printed electrodes. Dependence of peak height measured at carbonnanotube-based screen-printed electrodes on the concentration of amplicons is shown in Fig. 5B. It follows from the results obtained that the current response is higher compared with those measured at carbon screenprinted electrodes. Experimental data indicate that we are able to detect the signal of the amplified nucleic acid from the 2nd cycle of the PCR by using SWV and screenprinted electrodes with working electrode made from carbon nanotubes. www.electrophoresis-journal.com

122

Microfluidics and Miniaturization

Electrophoresis 2008, 29, 4964–4971

A120

B 120

Carbon electrode

4969

Carbon nanoelectrode

100

80

Peak height (%)

80

100

60 80 40 Peak height (%)

Peak height (%)

100

20

60

0 40

30 60 90 120 240 360 Time of accumulation (s)

60

40

20

20

0 0

10

20 PCR cycles

30

40

0 0

10

20 30 PCR cycles

Potentiostat

40

Figure 5. (A) Dependence of peak height on the number of PCR cycles (working electrode screen-printed carbon electrode); inset: influence of time of accumulation of PCR products onto the surface of screen-printed carbon electrode on peak height. (B) Dependence of peak height on the number of PCR cycles (working electrode carbon nanoelectrode). SWV parameters: potential step 5 mV, frequency 50 Hz. Peak height of 6.5 mA (inset in (A)), 15 mA (A) and 25 mA (B) corresponds to 100%.

electrode

Sample loading

Electrophoretic separation start +

Computer control

−

Gel electrophoresis control module

3.6 Coupling of gel electrophoresis with carbonnanotube-based screen-printed electrodes Recently, use of carbon nanotubes as a material for fabrication of screen-printed electrodes was published by several authors [45–50]. In the following experiment carbon& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Figure 6. Experimental scheme of coupling of gel electrophoresis with carbon nanoelectrodes

nanotube-based screen-printed electrodes were off-line coupled with gel electrophoresis. Off-line coupling was performed as follows: Into the agarose gel the electrodes for monitoring of DNA presence were placed. Further, amplicons were loaded into agarose gel wells. DNA migrating to the detection place was electrochemically analyzed. Agarose www.electrophoresis-journal.com

123

4970

Electrophoresis 2008, 29, 4964–4971

D. Huska et al.

A

B

100 90

6th cycle 80

Peak height (%)

70

th

4 cycle scan

60 50 40 30

100 nA

20

2nd cycle

10 background

1.3 0 2

1.0

4

6

1.1

8

10 15 20 PCR cycles

25

30

35

Potential (V)

gel electrophoresis was run for 5 min, and then stopped, and a measurement was carried out (Fig. 6). The electrochemical responses of PCR products obtained after 2, 4 and 6 PCR cycles are shown in Fig. 7A. The obtained signals were well developed and symmetric. When no DNA was present in the well on a gel, negligible signal of 1.1 V was detected. A photograph of the electrode placed into the agarose gel is shown in the inset of Fig. 7A. Dependence of the current response on the number of cycles is shown in Fig. 7B. When the PCR products were analyzed in the gel, it was possible to detect the signal of the amplified nucleic acid from the second cycle. The observed signal was proportional to the number of cycles. The separation on the agarose gel probably influences the amount of DNA migrating to the detection place, which could cause the observed differences between the results obtained by direct measurement in the solution and measurement in the agarose gel.

Figure 7. (A) Typical SW voltammograms of amplicons obtained after 2, 4 and/or 6 cycles, measured in agarose gel; inset: screen-printed electrode immersed in the gel. (B) Peak heights of PCR products separated by gel electrophoresis and measured by carbon nanoelectrode. Peak height of 20.5 mA corresponds to 100%.

The financial support from grant GA AV KAN208130801 is highly acknowledged. The authors have declared no conflict of interest.

5 References [1] Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J. et al., Science 1988, 239, 487–491. [2] Muyzer, G., Smalla, K., Antonie Van Leeuwenhoek 1998, 73, 127–141. [3] von Wintzingerode, F., Gobel, U. B., Stackebrandt, E., FEMS Microbiol. Rev. 1997, 21, 213–229. [4] Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C. et al., Nature 2001, 409, 860–921. [5] Garcia-Canas, V., Cifuentes, A., Electrophoresis 2008, 29, 294–309. [6] Kleparnik, K., Bocek, P., Chem. Rev. 2007, 107, 5279–5317.

4 Concluding remarks

[7] Hartinger, C. G., Keppler, B. K., Electrophoresis 2007, 28, 3436–3446.

Coupling of separation and detection instruments can bring many advantages. Here, we show a possibility to off-line couple gel electrophoresis as a standard and reliable separation technique with carbon-nanotube-based screen-printed electrodes, which represents new trends in microanalysis. Owing to the selectivity of gel electrophoresis and sensitivity of the electrochemical detection we are able to detect low amounts of PCR products of Phage Lambda DNA. This coupling could be considered as another possibility to visualize gel.

[8] Huang, Y. F., Huang, C. C., Hu, C. C., Chang, H. T., Electrophoresis 2006, 27, 3503–3522.

& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

[9] Greenspoon, S. A., Yeung, S. H. I., Johnson, K. R., Chu, W. K. et al., J. Forensic Sci. 2008, 53, 828–837. [10] Wang, C. C., Chang, J. G., Ferrance, J., Chen, H. Y. et al., Electrophoresis 2008, 29, 2904–2911. [11] Kanayama, N., Takarada, T., Shibata, H., Kimura, A., Maeda, M., Anal. Chim. Acta 2008, 619, 101–109. [12] Tsuji, T., Niida, Y., Electrophoresis 2008, 29, 1473–1483.

www.electrophoresis-journal.com

124

Electrophoresis 2008, 29, 4964–4971

Microfluidics and Miniaturization

4971

[13] Heide, B. R., Dromtorp, S. M., Rudi, K., Heir, E., Holck, A. L., Eur. Food Res. Technol. 2008, 227, 1125–1137.

[31] Novak, L., Neuzil, P., Pipper, J., Zhang, Y., Lee, S. H., Lab Chip 2007, 7, 27–29.

[14] Wu, D. P., Qin, J. H., Lin, B. C., J. Chromatogr. A 2008, 1184, 542–559.

[32] Neuzil, P., Zhang, C. Y., Pipper, J., Oh, S., Zhuo, L., Nucleic Acids Res. 2006, 34, 9.

[15] Krizkova, S., Hrdinova, V., Adam, V., Burgess, E. P. J. et al., Chromatographia 2008, 67, S75–S81.

[33] Ozkan-Ariksoysal, D., Tezcanli, B., Kosova, B., Ozsoz, M., Anal. Chem. 2008, 80, 588–596.

[16] Huska, D., Hubalek, J., Adam, V., Vajtr, D. et al., Talanta 2008, submitted.

[34] Meric, B., Kerman, K., Ozkan, D., Kara, P. et al., Talanta 2002, 56, 837–846.

[17] Prasek, J., Adamek, M., Hubalek, J., Adam, V. et al., Sensors 2006, 6, 1498–1512.

[35] Jelen, F., Tomschik, M., Palecek, E., J. Electroanal. Chem. 1997, 423, 141–148.

[18] Merino, E. J., Boal, A. K., Barton, J. K., Curr. Opin. Chem. Biol. 2008, 12, 229–237.

[36] Fojta, M., Electroanalysis 2002, 14, 1449–1463. [37] Wang, J., Bollo, S., Paz, J. L. L., Sahlin, E., Mukherjee, B., Anal. Chem. 1999, 71, 1910–1913.

[19] Guo, X. F., Gorodetsky, A. A., Hone, J., Barton, J. K., Nuckolls, C., Nat. Nanotechnol. 2008, 3, 163–167.

[38] Palecek, E., Nature 1960, 188, 656–657.

[20] Gorodetsky, A. A., Barton, J. K., Langmuir 2006, 22, 7917–7922.

[39] Palecek, E., Postbieglova, I., J. Electroanal. Chem. 1986, 214, 359–371.

[21] Boal, A. K., Barton, J. K., Bioconjug. Chem. 2005, 16, 312–321.

[40] Adam, V., Baloun, J., Fabrik, I., Trnkova, L., Kizek, R., Sensors 2008, 8, 2293–2305.

[22] O’Neill, M. A., Barton, J. K., Long-Range Charge Transfer in DNA I, Springer-Verlag Berlin, Berlin 2004, pp. 67–115.

[41] Petrlova, J., Masarik, M., Potesil, D., Adam, V. et al., Electroanalysis 2007, 19, 1177–1182.

[23] Drummond, T. G., Hill, M. G., Barton, J. K., Nat. Biotechnol. 2003, 21, 1192–1199.

[42] Wang, J., Tian, B. M., Sahlin, E., Anal. Chem. 1999, 71, 5436–5440. [43] Hart, J. P., Wring, S. A., Trends Analyt. Chem. 1997, 16, 89–103.

[24] Boon, E. M., Kisko, J. L., Barton, J. K., Redox Cell Biology and Genetics, Pt B, Academic Press Inc., San Diego 2002, pp. 506–522.

[44] Palecek, E., Talanta 2002, 56, 809–819.

[25] Boon, E. M., Barton, J. K., Curr. Opin. Struct. Biol. 2002, 12, 320–329.

[45] Lin, Y. H., Lu, F., Wang, J., Electroanalysis 2004, 16, 145–149.

[26] Boon, E. M., Salas, J. E., Barton, J. K., Nat. Biotechnol. 2002, 20, 282–286.

[46] Wang, J., Musameh, M., Analyst 2004, 129, 1–2.

[27] Kelley, S. O., Barton, J. K., Science 1999, 283, 375–381.

[47] Fanjul-Bolado, P., Queipo, P., Lamas-Ardisana, P. J., Costa-Garcia, A., Talanta 2007, 74, 427–433.

[28] Hall, D. B., Holmlin, R. E., Barton, J. K., Nature 1996, 382, 731–735.

[48] Sanchez, S., Pumera, M., Cabruja, E., Fabregas, E., Analyst 2007, 132, 142–147.

[29] Pipper, J., Zhang, Y., Neuzil, P, Hsieh, T. M., Angew. Chem. Int. Ed. Engl. 2008, 47, 3900–3904. [30] Pipper, J., Inoue, M., Ng, L. F. P., Neuzil, P. et al., Nat. Med. 2007, 13, 1259–1263.

& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

[49] Crevillen, A. G., Pumera, M., Gonzalez, M. C., Escarpa, A., Electrophoresis 2008, 29, 2997–3004. [50] Galandova, J., Ziyatdinova, G., Labuda, J., Anal. Sci. 2008, 24, 711–716.

www.electrophoresis-journal.com

125

5.4.2 Detekce nukleových kyselin amplifikovaných pomocí PCR za vyuţití miniaturizovaného elektrochemického detektoru.

Vývoj nových metod pro studium biologických procesů je stejně důleţité jako samotné studování biologických procesů. V tomto článku se zabýváme různými technikami (agarová elektroforéza, kapilární elektroforéza a elektrochemie) pro stanovení PCR produktu. Hlavním cílem bylo především zjistit moţnosti elektrochemie a její uplatnění v PCR a porovnat výsledky s uvedenými elektroforetickými technikami. Elektrochemické metody s sebou nesou výhody jako je schopnost automatizovat a miniaturizovat postupy a především detekovat velmi malé mnoţství vzorku oproti metodám klasickým jako je agarózový gel. Abychom mohli posoudit senzitivitu námi zvolených technik pro detekci PCR produktu, odebírali jsme vzorky průběţně z běţící PCR a to vţdy na konci 2., 4., 6., 8., 10., 15., 20., 25., a 30. cyklu. Poté byly vzorky analyzovány pomocí agarózové elektroforézy, kapilární čipové elektroforézy a elektrochemie na visící rtuťové kapkové elektrodě a na miniaturizovaných tištěných uhlíkových elektrodách. Nejdříve byly vzorky měřeny na agarózovém gelu obsahující etidium bromid. Nejniţší detekovatelné mnoţství DNA bylo při 20 cyklu. Kapilární čipová elektroforéza měla detekční limit DNA téměř dvakrát niţší neţ agarózový gel. Optimální detekovatelné mnoţství PCR produktu bylo moţné od 8 cyklu. Díky vysoké senzitivitě elektrochemických technik k nukleovým kyselinám byly tyto techniky pouţity i k detekci amplifikované DNA a to jak v klasické PCR tak i PCR v reálném čase (RT-PCR) (Vacek, a kol., 2011, Wang, a kol., 2003, Wang, a kol., 2003). HMDE umoţňuje detekovat NK ve velmi malých objemech 1 – 5 µl. Byli jsme schopni detekovat NK jiţ ve druhém cyklu probíhající PCR. Lineární závislost byla od 2 do 10 cyklu, poté byla závislost exponenciální. Přestoţe rtuťová elektroda poskytuje velmi dobrou citlivost je její pouţití v automatickém systému a moţnosti minituarizace nevhodná. Z tohoto důvodu jsme se zaměřili na testování uhlíkových elektrod. Konkrétně pak na tištěné miniaturní elektrody schopné zapojit do automatického systému a moţnosti další miniaturizace a provádění analýz in situ. Z výsledků vyplynulo, ţe testovaná uhlíková elektroda měla horší senzitivitu na měřenou DNA neţ elektroda rtuťová. Senzitivita uhlíkových elektrod se však dá výrazně zlepšit modifikací jejich povrchu nanočásticemi, při zachování schopnosti měření v automatickém systému

126

a in situ. Pro modifikaci povrchu tištěné uhlíkové elektrody jsme pouţili nanotrubice o velikosti 80 – 120 nm. Tím se nám podařilo výrazně zvětšit pracovní povrch elektrody a tím i její citlivost k DNA. Modifikovanými elektrodami se nám podařilo detekovat PCR produkt jiţ od druhého cyklu. Navíc jsme zcela unikátním uspořádáním provedli detekci amplifikované DNA přímo v agarozovém gelu, kdy jsme tištěnou elektrodu vnořili do gelu běţící elektroforézy. Porozumět biologickým procesům nelze bez analytických metod a přístrojů. Tímto článkem jsme ukázali schopnost detekovat PCR produkt v reálném čase pomocí elektrochemických technik, které přinášejí především vysokou citlivost a levnost v porovnání s běţnými přístroji a hlavně moţnost miniaturizace a provádět analýzy přímo v terénu.

127

5.4.3 Vědecký článek IV

Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids. Prasek, J.; Huska, D.; Jasek, O.; Zajickova, L.; Trnkova, L.; Adam, V.; Kizek, R.; Hubalek, J. Nanoscale Research Letters 2011, 6 IF = 2.560

Podíl autora Húska D.: 40 % textové části práce a 50% experimentální práce

128

Prasek et al. Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385

NANO EXPRESS

Open Access

Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids Jan Prasek1, Dalibor Huska2, Ondrej Jasek3, Lenka Zajickova3, Libuse Trnkova2, Vojtech Adam2, Rene Kizek2 and Jaromir Hubalek1*

Abstract The first aim of this study was to fabricate vertically aligned multiwalled carbon nanotubes (MWCNTs). MWCNTs were successfully prepared by using plasma enhanced chemical vapour deposition. Further, three carbon composite electrodes with different content of carbon particles with various shapes and sizes were prepared and tested on measuring of nucleic acids. The dependences of adenine peak height on the concentration of nucleic acid sample were measured. Carbon composite electrode prepared from a mixture of glassy and spherical carbon powder and MWCNTs had the highest sensitivity to nucleic acids. Other interesting result is the fact that we were able to distinguish signals for all bases using this electrode. Background In the last two decades, nanomaterials in the form of nanotubes and nanowires have begun to be reported as promising materials for wide field of applications [1,2]. Such materials could be also used for fabrication of miniaturized electrodes. The nanostructured electrodes could be fabricated using several techniques. The easiest fabrication technique is to use a mixture of nanomaterial as filler with a suitable vehicle, which could be deposited on the electrode substrate using screen-printing, drop-coating, dip-coating, spraying, etc. [3,4]. The disadvantage of these nanocomposition-based electrodes is the irreproducible electrode surface with undefined active electrode area. The reproducible nanostructured electrode surface could be fabricated using lithography as a common tool for microelectronics devices implementation [5], anodization process for nanorods or nanotubes creation [6,7]. One of these techniques is the creation of vertically aligned multiwalled carbon nanotubes (MWCNTs) grown directly on the surface using chemical vapour deposition (CVD) [8]. The aim of this study was to fabricate MWCNTs and further to test the particles as a part of carbon composite electrodes with commercial carbon particles on detection of nucleic acids. * Correspondence: [email protected] 1 Department of Microelectronics, Brno University of Technology, Technicka 10, CZ-61600 Brno, Czech Republic Full list of author information is available at the end of the article

Results and discussion Fabrication of vertically aligned MWCNTs

Primarily, vertically aligned MWCNTs were prepared. A detailed drawing of the current set-up of the apparatus for plasma enhanced CVD MWCNTs direct deposition is shown in Figure 1A. The apparatus consisted of a micro-wave generator, working at a frequency of 2.45 GHz, with a standard rectangular waveguide, transmitting the micro-wave power through a coaxial line to a hollow nozzle electrode. Ferrite circulator protected the generator from the reflected power by re-routing it to the water load. The coaxial line and the nozzle electrode accommodated a dual gas flow. The central conductor of the coaxial line was held in place by boron nitride ceramics. The outer conductor was terminated by a flange. A stub tuner was mounted to the waveguide for load matching, and the reactive mixture of CH4/H2 was added by a concentric opening instead of the set of holes in the outer housing. The plasma torch was enclosed by a quartz tube, 200 mm in length, with a duralumin shielding wrapped around the tube. The diameter of the quartz tube was 80 mm. The standard deposition mixture consisted of argon (700 sccm), methane (32 sccm) and hydrogen (255 sccm). Argon passed through the centre, whereas methane/hydrogen passed through the outer housing. The substrate for MWNT growth, a piece of alumina with sensor structure, was fixed on the quartz holder at the variable distance from the torch nozzle. It was heated by a heat

© 2011 Prasek et al; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

129

Prasek et al. Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385

A

Page 2 of 5

B

Figure 1 Preparation and characterization of MWCNTs. (A) Set-up of the apparatus for PECVD MWCNTs direct deposition (according to [8]). (B) Surface-enhanced micrographs of the electrodes fabricated on the Ag-based thick film paste (1) without and (2) with use of 10 nm Fe catalyst (Tescan, Czech Republic).

exchanger with hot gas and surface recombination. The deposition temperature was 700°C. The deposition was done on the pure silver layer without any catalyst and on the 10-nm-thick Fe catalyst using the same underlay. The SEM comparison of the electrode materials fabricated on the Ag thick film paste with and without use of catalyst is shown in Figure 1B. It clearly follows from the results obtained that both pastes are covered with vertically aligned MWCNTs. Detection of nucleic acids

Further, three carbon composite electrodes with different content of carbon particles with various shapes and sizes were prepared and tested on measuring of nucleic acids. The first carbon composite electrode (called as “microcarbon”) was made of 90% “glassy carbon powder,” where the particles are from glassy carbon material and they have spherical shape 2 μm (w/w, SigmaAldrich, USA) and 10% mineral oil (m/w, SigmaAldrich; free of DNase, RNase, and protease). The second one (called as “nanocarbon”) was made of 60% “glassy carbon powder” (w/w, Sigma-Aldrich), 30%

powdered cylinder carbon nanotubes (w/w, SigmaAldrich) and 10% mineral oil (w/w, Sigma-Aldrich). The third one was made of (called as “nanocarbon II”) 60% “glassy carbon powder” (w/w, Sigma-Aldrich), 30% above prepared MWCNTs and 10% mineral oil. These prepared materials were housed in a teflon body having a 2.5-mm-diameter disk surface. Before measurements, the electrode surface was renewed by polishing with a soft filter paper in preparation for measurement [9-11], which was carried out in the presence of 0.2 M acetate buffer (5.0). The prepared carbon composite electrodes were used in the following experiments, in which genomic DNA isolated from salmon (genomic salmon DNA) and oligonucleotide single strand from influenza (ODN influenza; 5’-CAG TCG CAA GGA CTA ATC TGT TTG-3’) were analysed. Carbon and/or graphite are of particular interest but its voltammetric response is complex as a result of its heterogeneous surface structure, where it exhibits both edge and basal plane sites and, depending upon how the graphite is aligned, the electrode may be predominantly basal or edge plane in character [12]. Numerous authors have been utilizing

130

Prasek et al. Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385

Page 3 of 5

electrode, but the height of cytosine was higher compared with thymine. At the surface of microcarbon electrode, the height of bases decreased in the following order thymine, guanine and cytosine. These changes can be associated with different surfaces and its affinity to single bases, which can subsequently influence the redox processes. To study the behaviour of bases on the surface of the electrodes, the dependences of adenine peak height on scan rate (50, 100, 200, 400, 600 and 800 mV/ s) were determined. The logarithmic dependences are shown in Figure 2A-C for microcarbon, nanocarbon and nanocarbon II electrodes, respectively. It clearly follows from the results obtained that ODN influenza gave higher signal compared with genomic salmon DNA except ODN influenza signal measured under 50 mV/s at nanocarbon II. If we compared the sharpness of the dependencies, then the sharpest were those measured at nanocarbon II electrode followed by nanocarbon electrode and microcarbon electrode. Moreover, the

carbon nanotubes for the electro-oxidation of DNA [13]. The edge plane sites on graphite are generally accepted to exhibit far greater rates of electron transfer as compared to the basal plane sites. Further, the adsorption of species on the graphite surfaces also differs at the two sites [14]. Therefore, the versatility of the electrode was tested. Cyclic voltammetry was used for the detection of two nucleic acids’ samples mentioned above and the basic electrochemical behaviour of nucleic acids at the surface of the above prepared carbon composite electrodes were studied. It is known that that cytosine, adenine, thymine and guanine give signals at carbon electrodes [15-17]. We found that both the nucleic acid samples gave all four signals corresponding to single bases at the tested electrodes. Adenine gave the highest signal; however, the sequence of height of the other bases measured on the electrodes differed. Guanine was the second-most electroactive bases at nanocarbon electrode followed by thymine and cytosine as well as at nanocarbon II

microcarbon

ln (siggnal (nA))

Potential (V V)

1.12

6 5

1 08 1.08 1.04 1

3.5

4.5

4 3

5.5

6.5

A

1.12 1.08 1.04

6 5 4

0 500 1000 Scan rate (mV/s)

45 4.5

55 5.5

65 6.5

75 7.5

35 3.5

E

0.80 E/V

0.84 0.95

1.05

T

G

3 —A

1.35

1.45

0.76

1.25

1.23

1.27 E/V

1.5

0.80 E/V

0.84

0.95

1.05

1.15 1.25 E/V

1.35

1.45 10 —A

1.0 E/V

C

300 nA

scan

influenza electrolyte 0.75

75 7.5

A

C

scan

0.5

65 6.5

1 nA

1.27 E/V

1.15 1.25 E/V

55 5.5

ln (scan rate (mV/s))

Genomic salmon DNA – nanocarbon II

5 nA

1.23

0 500 1000 Scan rate (mV/s)

30 —A A

0.76

1 —A

45 4.5

ln (scan rate (mV/s))

T 200 nA

1.15 1.10 1.05 1.00

3 35 3.5

Influenzas’ oligonucleotide – nanocarbon II G

ODN influenza Genomic salmon DNA

7

2

7.5

ln (scan rate (mV/s)) D

9 8

5

0 1,000 Scan rate (mV/s)

4

C

ODN influenza Genomic salmon DNA

6

8 7

7

Potential (V)

9

ln (siignal (nA))

B

ODN influenza Genomic salmon DNA

nanocarbon II

ln (siggnal (nA))

10

Potential (V)

A

nanocarbon

salmon electrolyte

0.5

0.75

1.0 E/V

1.25

1.5

Figure 2 Cyclic voltammetry. The dependences of adenine peak height on ln of scan rates (50, 100, 200, 400, 600 and 800 mV/s) measured at (A) microcarbon, (B) nanocarbon and (C) nanocarbon II. In insets: dependencies of adenine peak potentials on ln of scan rate. Square wave voltammetry. SW voltammograms of (D) single strand oligonucleotide influenza (13 μg/mL), and (E) double strand genomic DNA (15 μg/mL). In insets: signals of all nucleic acid bases after baseline correction and smoothing of raw data.

131

Prasek et al. Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385

dependencies of adenine peak potentials on scan rate were determined and are shown in insets in Figure 2AC for microcarbon, nanocarbon and nanocarbon II electrodes, respectively (R 2 higher than 0.998). Based on both the logarithmic and linear dependencies, we found that the redox electrode process at all electrodes was diffusion-limited. Moreover, based on the Randles-Sevcik equation for a reversible and diffusion-controllable process, we estimated that the reaction exhibited nearly heterogeneous one-electron transfer. Moreover, the dependences of adenine peak height on concentration of nucleic acid sample were measured. The dependences were strictly linear for both nucleic acid samples with R2 higher than 0.996. The slope of the obtained curves enhanced as follows: nanocarbon II > nanocarbon > microcarbon. It clearly follows from the results obtained that carbon composite electrode prepared from the mixture of glassy and spherical carbon powder and MWCNTs had the highest sensitivity to nucleic acids. Based on these results, nanocarbon II electrodes were further utilized for detection of both the nucleic acids’ samples (25 μg/mL) using square wave voltammetry (not shown). We were interested in the issue whether we could detect signals of all bases due to such high sensitivity. Both the nucleic acids samples (15 μg/mL) were detected, and all purine and pyrimidine bases signals were observed (Figure 2D, E, for ODN influenza and genomic salmon DNA, respectively); peak potential about G = 0.8 V; A = 1.05, T = 1.25 and C = 1.35 V. Signals of the genomic DNA were higher (approx. 30%) in comparison with the oligonucleotide. Another interesting result is the fact that we were able to clearly distinguish signals for all bases by using baseline correction and smoothing (insets in Figure 2D, E).

Conclusions Based on these promising milestones of electroanalysis of nucleic acids together with the fact that electrochemistry is still one of the most sensitive analytical technique voltammetric methods can be considered as a suitable tool for detection of nucleic acids. We show the successful application of modern nano-technologies not only for detecting of nucleic acids but also for distinguishing of all bases signals. Methods Chemicals

All chemicals of ACS purity used and parafilm were purchased from Sigma-Aldrich Chemical Corp. (USA) unless noted otherwise. Salmon sperm DNA was bought from Applied Biosystems (USA). Synthetic oligonucleotides, which were purified using high performance liquid chromatography, were obtained from Sigma-Aldrich with following sequence: influenza HPI 5’-CAG TCG

Page 4 of 5

CAA GGA CTA ATC TGT TTG-3’. Stock standard solutions of the oligonucleotides (100 μg/mL) were prepared with water of ACS purity (Sigma-Aldrich) and stored in dark at -20°C. The concentrations of oligonucleotides and DNA were determined spectrophotometrically at 260 nm using spectrometer Specord 210 (Analytic Jena, Germany). Deionised water underwent demineralization by reverse osmosis using the instrument Aqua Osmotic 02 (Aqua Osmotic, Czech Republic), and then it was subsequently purified using Millipore RG (Millipore Corp., USA, 18 MΩ) - MiliQ water. The pH value was measured using inoLab controlled by the personal computer program (MultiLab Pilot; WTW, Germany). Electrochemical analysis

Electrochemical measurements were performed using AUTOLAB PGS30 Analyzer (EcoChemie, Netherlands) connected to VA-Stand 663 (Metrohm, Switzerland), using a standard cell with three electrodes. Carbon composite electrodes were employed as the working electrode. An Ag/AgCl/3 M KCl electrode served as the reference electrode. Glassy carbon electrode was used as the auxiliary electrode. For smoothing and baseline correction, the software GPES 4.9 supplied by EcoChemie was employed. Cyclic voltammetric parameters were as follows: potential step 5 mV; scan rates: 50, 100, 200, 400, 600 and 800 mV/s. Cyclic and square wave voltammetric measurements were carried out in the presence of acetate buffer pH 5. Square wave voltammetry parameters: potential step 5 mV, frequency 280 Hz. The samples measured by square wave voltammetry were deoxygenated before measurements by purging with argon (99.999%) saturated with water for 120 s. The temperature of supporting electrolyte was maintained by the flow electrochemical cell coupled with thermostat JULABO F12/ED (Labortechnik GmbH, Germany) and was 25°C [18]. Abbreviations CVD: chemical vapour deposition; MWCNTs: multiwalled carbon nanotubes. Acknowledgements The study was supported by the Czech grant projects GACR 102/09/P640, NANIMEL GACR 102/08/1546 and GACR P205/10/1374. Author details 1 Department of Microelectronics, Brno University of Technology, Technicka 10, CZ-61600 Brno, Czech Republic 2Department of Chemistry and Biochemistry, Mendel University in Brno, Zemedelska 1, CZ-61300 Brno, Czech Republic 3Department of Physical Electronics, Masaryk University, Kotlarska 2, CZ-61137 Brno, Czech Republic Authors’ contributions JP prepared the screen-printed alumina substrates for MWCNTs deposition, characterised MWCNTs using SEM and participated on paper drafting. DH carried out electrochemical measurements. OJ physically prepared MWCNTs. LZ participated on physically preparation of MWCNTs and on their

132

Prasek et al. Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385

characterization. LT treated electrochemical data and participated in preparation of the manuscript. VA participated in the design of the study and performed the analysis of the data. RK conceived of the study, and participated in its design. JH participated in design and coordination of the study and drafted manuscript.

Page 5 of 5

doi:10.1186/1556-276X-6-385 Cite this article as: Prasek et al.: Carbon composite micro- and nanotubes-based electrodes for detection of nucleic acids. Nanoscale Research Letters 2011 6:385.

Competing interests The authors declare that they have no competing interests. Received: 27 October 2010 Accepted: 16 May 2011 Published: 16 May 2011 References 1. Sadaf JR, Israr MQ, Kishwar S, Nur O, Willander M: White electroluminescence using ZnO nanotubes/GaN heterostructure lightemitting diode. Nanoscale Res Lett 2010, 5:957-960. 2. Wang SQ, Li GH, Du GD, Li L, Jiang XY, Feng CQ, Guo ZP, Kim S: Synthesis and characterization of cobalt-doped WS2 nanorods for lithium battery applications. Nanoscale Res Lett 2010, 5:1301-1306. 3. Prasek J, Adamek M, Hubalek J, Adam V, Trnkova L, Kizek R: New hydrodynamic electrochemical arrangement for cadmium ions detection using thick-film chemical sensor electrodes. Sensors 2006, 6:1498-1512. 4. Albareda-Sirvent M, Merkoci A, Alegret S: Configurations used in the design of screen-printed enzymatic biosensors. A review. Sens Actuator B Chem 2000, 69:153-163. 5. Lisboa P, Valsesia A, Colpo P, Rossi F, Mascini M: Nanopatterned surfaces for bio-detection. Anal Lett 2010, 43:1556-1571. 6. Jian SR, Chen YT, Wang CF, Wen HC, Chiu WM, Yang CS: The influences of H-2 plasma pretreatment on the growth of vertically aligned carbon nanotubes by microwave plasma chemical vapor deposition. Nanoscale Res Lett 2008, 3:230-235. 7. Klosova K, Hubalek J: Advanced electrodes with nanostructured surfaces for electrochemical microsensors. Phys Status Solidi A Appl Mater 2008, 205:1435-1438. 8. Zajickova L, Jasek O, Elias M, Synek P, Lazar L, Schneeweiss O, Hanzlikova R: Synthesis of carbon nanotubes by plasma-enhanced chemical vapor deposition in an atmospheric-pressure microwave torch. Pure Appl Chem 2010, 82:1259-1272. 9. Kizek R, Masarik M, Kramer KJ, Potesil D, Bailey M, Howard JA, Klejdus B, Mikelova R, Adam V, Trnkova L, Jelen F: An analysis of avidin, biotin and their interaction at attomole levels by voltammetric and chromatographic techniques. Anal Bioanal Chem 2005, 381:1167-1178. 10. Masarik M, Kizek R, Kramer KJ, Billova S, Brazdova M, Vacek J, Bailey M, Jelen F, Howard JA: Application of avidin-biotin technology and adsorptive transfer stripping square-wave voltammetry for detection of DNA hybridization and avidin in transgenic avidin maize. Anal Chem 2003, 75:2663-2669. 11. Petrlova J, Krizkova S, Supalkova V, Masarik M, Adam V, Havel L, Kramer KJ, Kizek R: The determination of avidin in genetically modified maize by voltammetric techniques. Plant Soil Environ 2007, 53:345-349. 12. Banks CE, Compton RG: Edge plane pyrolytic graphite electrodes in electroanalysis: an overview. Anal Sci 2005, 21:1263-1268. 13. Erdem A: Nanomaterial-based electrochemical DNA sensing strategies. Talanta 2007, 74:318-325. 14. Ji XB, Kadara RO, Krussma J, Chen QY, Banks CE: Understanding the physicoelectrochemical properties of carbon nanotubes: current state of the art. Electroanalysis 2010, 22:7-19. 15. Oliveira-Brett AM, Piedade JAP, Silva LA, Diculescu VC: Voltammetric determination of all DNA nucleotides. Anal Biochem 2004, 332:321-329. 16. Adam V, Huska D, Hubalek J, Kizek R: Easy to use and rapid isolation and detection of a viral nucleic acid by using paramagnetic microparticles and carbon nanotubes-based screen-printed electrodes. Microfluid Nanofluid 2010, 8:329-339. 17. Huska D, Adam V, Babula P, Hrabeta J, Stiborova M, Eckschlager T, Trnkova L, Kizek R: Square-wave voltammetry as a tool for investigation of doxorubicin interactions with DNA isolated from neuroblastoma cells. Electroanalysis 2009, 21:487-494. 18. Huska D, Hubalek J, Adam V, Vajtr D, Horna A, Trnkova L, Havel L, Kizek R: Automated nucleic acids isolation using paramagnetic microparticles coupled with electrochemical detection. Talanta 2009, 79:402-411.

Submit your manuscript to a journal and benefit from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the field 7 Retaining the copyright to your article

Submit your next manuscript at 7 springeropen.com

133

5.4.4 Mikro a nano-trubicemi modifikované pevné elektrody pro detekci nukleových kyselin. V posledních letech dochází k vývoji nových materiálů zaloţených na nanočásticích. Nanočástice se nevyhnuly i biologii, kde se především vyuţívají pro izolaci i transport látek ale i pro modifikace povrchů detekčních elektrod umoţňující měřit analyty v malých mnoţstvích a při velmi nízkých koncentracích, čímţ dostáváme nové poznatky o biologických procesech. Velký zájem o rychlou a senzitivní analýzu nukleových kyselin roste především v oblasti transkriptimiky a genomiky. Jednou z moţností jsou elektrody modifikované nanotrubicemi. Tento článek pojednává o moţnostech vyuţití tištěných elektrod o velikosti 2 cm modifikovaných uhlíkovými nanotrubicemi pro detekci nukleových kyselin. Celkem byly připraveny tři druhy uhlíkových pastových elektrod. Základem kaţdé elektrody byl skelný uhlík 2 µm a minerální olej. První elektroda obsahovala pouze zmíněný skelný uhlík 90% a 10% minerálního oleje a byla nazvána jako „microcarbon―. Druhá elektroda se skládala z 60% skleného uhlíku a 30 % nanotrubic zakoupených od firmy Sigma Aldrich, USA powdered cylinder carbon nanotubes a 10% minerálního oleje. Tato elektroda byla nazvána jako „nanocarbon―. Třetí elektroda byla vytvořena z 60% skleného uhlíku a 30 % nanotrubic (MWCNTs - multiwalled carbon nanotubes) a 10% minerálního oleje. Třetí elektroda byla nazvána jako „nanocarbonII―. Po přípravě jednotlivých elektrod jsme mohli přistoupit k vlastnímu testování. Nejdříve byly měřeny jednotlivé dusíkaté báze na referenční elektrodě „microcarbon―. Jednotlivé píky se vyskytovaly v následujících potenciálech: 0.1 mM Guanin – (0.824 V); 1 mM Adenin – (1.076 V); 1 mM Tymin – (1.168 V); 1 mM Cytosin – (1.368 V). Nejmenší signál poskytoval cytosin. Voltametrické záznamy roztoku obsahující všechny 4 báze – mix bází (Adenin, Tymin, Cytosin = 1 mM; Guanin = 0,1 mM); měřené v acetátovém pufru pH = 5 na referenční elektrodě „microcarbon― a na elektrodách obsahující uhlíkové nanotrubice (nanocarbon, nanocarbonII). Zobrazené voltamogramy jsou po úpravě baseline, kterou umoţňuje program GPES. Pokud srovnáme jednotlivé záznamy mix bází, pozorujeme, ţe „microcarbon― poskytuje signál všech 4 bází. Signály jsou ovšem oproti „nanocrabon― a „nanocarbon II― elektrody menší ty ale naopak neposkytují signál cytosinu, přičemţ proudová odezva je podstatně větší. Pokud se podíváme na sumu signálů, zjistíme, ţe „nanocarbon ― je o 90 % senzitivnější neţ „microcarbon― a

134

„nanocarbon II― má o 26 % vyšší senzitivitu neţ „microcarbon―. „nanocrabon―a „nanocarbon II― elektrody zase naopak nedetekují všechny báze. I přesto lze poukázat na potenciál uhlíkových nanotrubic jako přídavku do pastových elektrod. Další práce se proto musí zaměřit na hledání optimálního poměru nanotrubic a uhlíku, který zajistí detekci všech bází a zároveň zvýší senzitivitu elektrod.

135

5.4.5 Vědecký článek V

Automated nucleic acids isolation using paramagnetic microparticles coupled with electrochemical detection. Huska, D.; Hubalek, J.; Adam, V.; Vajtr, D.; Horna, A.; Trnkova, L.; Havel, L.; Kizek, R.

Talanta 2009, 79 (2), 402-411 IF = 3.722 Podíl autora Húska D.: 30 % textové části práce a 80% experimentální práce

136

Talanta 79 (2009) 402–411

Contents lists available at ScienceDirect

Talanta journal homepage: www.elsevier.com/locate/talanta

Automated nucleic acids isolation using paramagnetic microparticles coupled with electrochemical detection Dalibor Huska a,b , Jaromir Hubalek c , Vojtech Adam a,d , David Vajtr e , Ales Horna f , Libuse Trnkova g , Ladislav Havel b , Rene Kizek a,∗ a

Department of Chemistry and Biochemistry, Mendel University of Agriculture and Forestry, Zemedelska 1, CZ-613 00 Brno, Czech Republic Department of Plant Biology, Mendel University of Agriculture and Forestry, Zemedelska 1, CZ-613 00 Brno, Czech Republic Department of Microelectronics, Faculty of Electrical Engineering and Communication, Brno University of Technology, Udolni 53, CZ-602 00 Brno, Czech Republic d Department of Animal Nutrition and Forage Production, Faculty of Agronomy, Mendel University of Agriculture and Forestry, Zemedelska 1, CZ-613 00 Brno, Czech Republic e Department of Clinical Biochemistry and Pathobiochemistry, 2nd Faculty of Medicine, Charles University, V Uvalu 84, CZ-150 06 Prague 5, Czech Republic f Faculty of Technology, Tomas Bata University, T.G. Masaryka 275, CZ-762 72 Zlin, Czech Republic g Department Chemistry, Faculty of Science, Masaryk University, Kotlarska 2, CZ-611 37 Brno, Czech Republic b c

a r t i c l e

i n f o

Article history: Received 6 June 2008 Received in revised form 29 March 2009 Accepted 1 April 2009 Available online 10 April 2009 Keywords: mRNA Isolation Magnetic particle and bead Cyclic voltammetry Square wave voltammetry Brain tissue Maize plants Cadmium

a b s t r a c t Easy, efficient and low demanding separation of mRNA from biological material is needed to study gene expression and to use in chip technologies. It is common knowledge that each mRNA molecule contains sequence of 25 adenines. This feature can be used for binding mRNA on the surface of the particles coated by thymine chains. The present work reports on suggesting and optimizing of mRNA separation and detection from biological material via paramagnetic microparticles coupled with electrochemical detection. Primarily we optimized cyclic and square wave voltammetric conditions to detect poly(A), which was used as standard to mimic behaviour of mRNA. Under the optimized square wave voltammetric conditions (frequency 280 Hz, accumulation time 200 s, supporting electrolyte and its temperature: acetate buffer 4.6 and 35 ◦ C) we estimated detection limit down to 1 ng of poly(A) per ml. To enhance effectiveness and repeatability of isolation of nucleic acid automated approach for rinsing and hybridizing was proposed. We optimized the whole procedure and experimental conditions. Using automated way of isolation and under optimized conditions the yield of poly(A) (isolated concentration of poly(A)/given concentration of poly(A)*100) was approximately 75%. The suggested and optimized method for poly(A) isolation and detection was utilized for the analysis of brain tissues of patients with traumatic brain injury. The total amount of isolated mRNA varied from 40 to 760 g of mRNA per g of brain tissue. The isolation of mRNA from six samples per run was not longer than 2.5 h. Moreover, we applied the optimized procedure on fully automated pipetting instrument to isolate mRNA. The instrument was successfully tested on the analysis of extracts from roots of maize plants treated with cadmium(II) ions. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Simple, rapid and reproducible isolation of nucleic acids with high purity is needed in a wide range of molecularly biological procedures. We are able to obtain nucleic acids with sufficient purity by the most commonly used method based on phenol–chloroform extraction; however, the whole procedure is laborious and time consuming. Due to this fact methods and approaches have been developing to shorten the time of isolation and to obtain nucleic

Abbreviations: CV, cyclic voltammetry; SWV, square wave voltammetry; HMDE, hanging mercury drop electrode; MPs, magnetic particles; mRNA, messenger ribonucleic acid; NA, nucleic acid; poly(A), polyadenylic acid. ∗ Corresponding author. Tel.: +420 5 4513 3350; fax: +420 5 4521 2044. E-mail address: [email protected] (R. Kizek).

acids with sufficient purity to be analysed by polymerase chain reaction and other molecularly biological methods [1–4]. Nucleic acids isolation using paramagnetic or superparamagnetic particles (MPs) represents promising tool for this purpose [5–7]. MPs, whose size is ranging from nm to mm, respond to external magnetic field and facilitate bioactive molecules binding because of their affinity for the MPs modified surface made of biological components [8–11]. The paramagnetic properties of the particles enable us to use magnetic force for transferring of the beads or for rinsing of nonbinding, otherwise commonly interfering substances. Among other advantages of MPs easy-to-use, non-laborious relatively rapid sample preparation without centrifugation and dialysis compared to conventional purification techniques belong. The time needed to get target biomolecule is also reduced due to the fact that binding of the biomolecule by MPs can protect it against physical and biological damage, e.g. denaturation [12]. Physico-chemical prop-

0039-9140/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.talanta.2009.04.007

137

D. Huska et al. / Talanta 79 (2009) 402–411

erties of MPs (e.g. their size, surface topography) are important to evaluate their usage in biology [13–21]. The mostly used MPs in biosensors applications are superparamagnetic nanoparticles composed of ferrous oxide or ferric oxide [22]. Small particles with size from 1 to 10 nm are paramagnetic, but larger particles (mm) are ferromagnetic. Nanoparticles have a lot of physico-chemical advantages [23,24]. Their size can be adapted to the extension and kind of a biological sample, which is a source of target biomolecules (e.g. proteins 5–50 nm, viruses 20–450 nm, cells 10–100 ␮m) [15,25,26]. Nanoparticles from ferric oxide also provide surface suitable for biomolecules binding. Methods of magnetic particles synthesis are largely discussed [9]. There are two ways to find how MPs can be modified. The first way is based on electric envelope layer for electrostatic adsorption of biomolecules. This method compared to conventional methods enables to avoid organic solvents. Matsunaga et al. modified the surface of MPs using electrically positive amino groups. Isolation was based on mutual electrostatic activities between negatively charged DNA and positively charged MPs [27]. The second way of paramagnetic particles surface modification is based on biomolecules anchored on particles. These biomolecules specifically bind target biomolecules [28–30]. On this method it is based also mRNA isolation. Oligo(deoxythymine)25 anchored on the surface of MPs can be hybridized to mRNA molecule due to the presence of single chain sequence of tens adenines at the very end of all mRNA molecules [29]. MPs are commonly coupled with optical detection including fluorescent dyes. In addition, the isolated molecules can also be detected by electrochemical methods [28,31–35]. The main aim of this work was to automate isolation of mRNA using paramagnetic microparticles and detect the isolated nucleic acids by cyclic and square wave voltammetry both coupled with adsorptive transfer technique. 2. Materials and methods All chemicals of ACS purity used and parafilm were purchased from Sigma–Aldrich Chemical Corp. (Sigma–Aldrich, USA) unless noted otherwise. Synthetic polyadenylic acid (poly(A)) was used as a standard. Stock standard solution of poly(A) (100 ␮g/ml) was prepared from lyophilized poly(A) (0.5 mg/ml, Mr = 400,000) with water of ACS purity (Sigma–Aldrich) and stored in dark at −20 ◦ C. The concentration of poly(A) was determined spectrophotometrically at 260 nm using spectrometer Spectronic Unicam (UK). The pH values were measured using WTW inoLab Level 3 with terminal Level 3 (Weilheim, Germany). All the chemicals used for the preparation of plant cultivation media were purchased from Duchefa (Netherlands). 2.1. Instrumentation for poly(A) isolation Isolation of poly(A) and mRNA was carried out using paramagnetic particles Dynabeads Oligo (dT)25 (Invitrogen, USA) and magnetic stand Dynal Magnetic Particle Concentrator-S supplied by Dynal A.S (Norway). All experiments with paramagnetic particles were performed in RNA/DNA UV cleaner box UVT – S – AR (Biosan, Latvia). For centrifuging and vortexing of a sample multi-spin MSC3000 centrifuge (Biosan, Latvia) placed in UV cleaner box was used. Denaturation was carried out at 85 ◦ C using the Thermomixer 5355 Comfort/Compact (Eppendorf, Germany). The buffers used in our experiments were as follows: (a) phosphate buffer I: 0.1 M NaCl + 0.05 M Na2 HPO4 + 0.05 M NaH2 PO4 ; (b) phosphate buffer II: 0.2 M NaCl + 0.1 M Na2 HPO4 + 0.1 M NaH2 PO4 ; (c) acetate buffer: 0.2 M CH3 COOH + 0.2 M CH3 COONa. Hybridization solution: 100 mM Na2 HPO4 + 100 mM NaH2 PO4 , 0.5 M NaCl,

403

0.6 M guanidinium thiocyanate, 0.15 M Trizma base adjusted by HCl on pH of 7.5. 2.2. Fully automated isolation of nucleic acids Fully automated isolation was carried out on automated pipetting system epMotion 5075 (Eppendorf, Germany). The position of B4 is a magnetic separator (Promega). The positions of C1 and C4 can be thermostated (Epthermoadapter PCR96). The pipetting provides a robotic arm with adapters (TS50, TS300 and TS1000) and Gripper (TG-T). The samples are placed in the position B3 in adapter Ep0.5/1.5/2 ml. Module Reservoir is located in the position B1, where washing solutions and waste are available. The device is controlled by the epMotion control panel. The tips are located in the A4 (ePtips 50), A3 (ePtips 300) and A2 (ePtips 1000) positions. PCR 96 plates are used. The resulting volumes of collected samples ranged from 10 to 30 ␮l depending on the procedure. 2.3. Electrochemical analysis Electrochemical measurements were performed with AUTOLAB PGS30 Analyzer (EcoChemie, Netherlands) connected to VA-Stand 663 (Metrohm, Switzerland), using a standard cell with three electrodes. A hanging mercury drop electrode (HMDE) with a drop area of 0.4 mm2 was employed as the working electrode. An Ag/AgCl/3 M KCl electrode served as the reference electrode. Glassy carbon electrode was used as the auxiliary electrode. For smoothing and baseline correction the software GPES 4.9 supplied by EcoChemie was employed. Cyclic voltammetric or square wave voltammetric measurements were carried out in the presence of acetate buffer pH 4 or 4.6. CV parameters were as follows: potential step 5 mV, scan rates 10, 20, 40, 80, 160 and 320 mV/s. Square wave voltammetry parameters: potential step 5 mV and frequency 280 Hz. The samples measured by cyclic and square wave voltammetry were deoxygenated prior to measurements by purging with argon (99.999%) saturated with water for 120 s. The temperature of supporting electrolyte was maintained by the flow electrochemical cell coupled with thermostat JULABO F12/ED (Labortechnik GmbH, Germany). 2.4. In vitro plants cultivation Maize (Zea mays L.) F1 hybrid Gila was used in our experiments. Maize kernels were sterilized with sodium hypochlorite (5%, v/v), washed with water and germinated on wet filter paper in special vessels at 23 ± 2 ◦ C in dark. After seven days, each maize seedling was placed into glassy test-tube containing Murashige Skoog medium with gerlit [36] and with addition of Cd(II)ethylenediaminetetraacetic acid (Cd(II)-EDTA, 0, 5, 10, 25, 50 and 100 ␮M). Plants grown without Cd(II)-EDTA (0 ␮M) were used as a control. These seedlings were cultivated in Versatile Environmental Test Chamber (MLR-350 H, Sanyo, Japan) for five days with 14 h long daylight per day (maximal light intensity was 70 lx) at a temperature 23.5–25 ◦ C and humidity 71–78%. Three plants each were harvested at certain time intervals (24, 48, 72, 96 and 120 h) during the experiment, and their roots were rinsed three times in distilled water and 0.5 M EDTA. In addition, each harvested plant was divided into leaves and roots. Fresh weight of the samples was measured immediately after the rinsing by using a Sartorius scale. 2.5. Preparation of plant tissues for mRNA isolation Weighed plant tissues (approximately 0.2 g) were transferred to a test-tube, and liquid nitrogen was added. The samples were frozen to disrupt the cells. The frozen sample was transferred to mortar and grinding for 1 min. Then, 1000 ␮l of 0.2 M phosphate buffer (pH 7.2) was added to the mortar, and the sample was grinding

138

404

D. Huska et al. / Talanta 79 (2009) 402–411

for 5 min. The homogenate was transferred to a new test-tube. The mixture was homogenised by shaking on a Vortex–2 Genie (Scientific Industries, New York, USA) at 4 ◦ C for 30 min. The homogenate was centrifuged (14 000 × g) for 30 min at 4 ◦ C using a Universal 32 R centrifuge (Hettich-Zentrifugen GmbH, Tuttlingen, Germany). Before the analysis the supernatant was filtered through a membrane filter (0.45 ␮m Nylon filter disk, Millipore, Billerica, Mass., USA). 2.6. Patients with brain disorders We have investigated blood samples of patients with brain disorders. All patients (n = 6) received cranial computerized tomography (CT). Five patients were diagnosed as focal traumatic brain injury (TBI) according to the CT scan performed during admission, and one patient was diagnosed as cerebral stroke (sample 6CE). Four patients with TBI were submitted to neurosurgery (samples 1NM, 2SE, 3SEL, 4MA) due to expansive contusion with midline shift of more than 10 mm, and intra-cranial pressure elevation of more than 10 Torr, and one patient without expansive behaviour of contusion (sample 5HA) with suspicion on diffuse axonal injury. Informed agreement: The ethics committee at each institution approved this study Written informed consent was obtained from all patients. The group II of controls (n = 6) included patients with non-traumatic diagnosis. 2.7. Preparation of brain tissues for mRNA isolation To the sample of brain tissue (approximately 200 mg of tissue, obtained from patients with serious brain injury) guanidinium thiocyanate (4 M, pH 7.5) was added. pH of this solution was adjusted by 1 M Tris–HCl to 7.5. The cells were lyzed by vortexing until the eye-observable precipitates disappeared. To the homogenate: (i) 50 ␮l 2 M of sodium acetate pH 4.1, (ii) 450 ␮l of phenol, (iii) 130 ␮l of chloroform:isoamyl alcohol (49:1, v/v) was added. This mixture was vortexed for 10–30 s until the emulsion was formed and then incubated for 15 min on ice. Then the sample was centrifuged for 15 min at 14,000 rpm, 4 ◦ C. After the centrifugation the upper phase containing total RNA was collected. This phase was transferred to new test-tube prior to analysis by magnetic microparticles. 2.8. Statistical analyses Data were processed using MICROSOFT EXCEL® (USA) and STATISTICA.CZ Version 8.0 (Czech Republic). Results are expressed as mean ± standard deviation (S.D.) unless noted otherwise (EXCEL® ). Statistical significances of the differences between mRNA content in roots of plants treated with cadmium(II) ions and control plants were determined using STATISTICA.CZ. Differences with p < 0.05 were considered significant and were determined by using of one way ANOVA test (particularly Scheffeho test), which was applied for means comparison. 3. Results and discussion More than 40 years ago Palecek discovered using oscillopolarography that nucleic acids gave two signals: (i) redox signal of adenine and cytosine, and (ii) oxidative signal of guanine [37–39]. Recently elimination voltammetry has been successfully utilized for resolution of reduction signal of adenine and cytosine [40–45]. Moreover it was published that cytosine, adenine, thymine and guanine gave signals at carbon electrodes [31,46,47]. Based on these promising milestones of electroanalysis of nucleic acids together with the fact that electrochemistry is still one of the most sensitive analytical technique, voltammetric methods can be

considered as a suitable tool for the detection of nucleic acids [48–50]. 3.1. Electrochemical optimization detection of poly(A) 3.1.1. Electrochemical behaviour of poly(A) investigated by adsorptive transfer technique in connection with cyclic voltammetry Nucleic acids can be accumulated onto surface of HMDE easily. Therefore, it is possible to use adsorptive transfer technique for their detection. The description of this technique follows. A working electrode with well-defined surface due to unique physico-chemical properties of mercury is renewed (Fig. 1A,a). An analysed sample in very low volume (5 ␮l) is introduced onto parafilm (Fig. 1A,b). The working electrode is immersed into the sample and nucleic acid is adsorbed for the desired time of accumulation (Fig. 1A,c). Then the working electrode is rinsed in water of ACS purity and supporting electrolyte (Fig. 1A,d). Finally the working electrode with adsorbed nucleic acid is transferred into electrochemical cell with supporting electrolyte and analysed (Fig. 1A,e). The principle of poly(A) isolation by using of paramagnetic particles is shown in Fig. 1B. Nucleic acids with homo-adenine sequence (poly(A)) are captured by the particles with chains of homo-thymidine anchored on their surface. Due to the principle of complementarity of nucleic acid bases hybridization of poly(A) with homo-thymidines takes place (Fig. 1B,a). Non-specifically linked molecules due to other types of attractive forces are washed due to rinsing step. Hybridized poly(A) is cleaved by heat treatment (Fig. 1B,b). Then, the particles are forced by magnetic field and only poly(A) containing solution is collected (Fig. 1B,c). The collected solution is analysed (Fig. 1B,d). Cyclic voltammetry is a commonly used method for the analysis of DNA [29,30,43]. The ammonium formiate is the most often used supporting electrolyte, but the mechanisms of electrode processes are still not clear. It is supposed that the supporting electrolyte provides proton, which is bound to DNA molecule and then the reduction of adenine and cytosine occurs. The dependence of the peak height of poly(A) (100 ␮g/ml) measured by cyclic voltammetry on scan rate was studied (Fig. 2A). The typical voltammograms of poly(A) measured at three scan rates (40, 80 and 160 mV/s) are shown in inset in Fig. 2A. The cyclic voltammetry gives well-developed symmetric reduction peaks within the potential range from −1.25 to −1.3 V. Peak height enhanced with increasing scan rate linearly according to the following equation y = 74.943x + 6.0057 and R2 = 0.9918. Symmetry of the peak was poor at scan rate higher than 320 mV/s. Therefore we applied scan rate of 160 mV/s in the following experiments. The time of nucleic acids accumulation onto the working electrode surface belongs to the one of the most important experimental conditions needs to be optimized. The sample (volume 5 ␮l) was accumulated onto the surface of HMDE for the 30, 60, 90, 120, 150, 180 and 210 s at open circuit. We found that the height of adenine peak enhanced with the time of accumulation up to 120 s, then gradually decreased (Fig. 2B). The observed decrease in adenine peak height at accumulation time higher than 120 s can be associated to length of poly(A) chains, which could form poly-layer structures on the surface of HMDE. The influence of the poly(A) concentration on the current response at the accumulation time of 120 s is shown in Fig. 2C. Redox signal of adenine was proportional to the concentration of poly(A) up to 35 ␮g/ml, then the signal enhanced slowly. The linear dependence was measured within the range from 0.4 to 25 ␮g/ml with equation y = 1.204x + 888.5, R2 = 0.992 (Table 1). The obtained experimental data were repeatable very well with relative standard deviations 5.5% (n = 5).

139

D. Huska et al. / Talanta 79 (2009) 402–411

405

Fig. 1. (A) Electrochemical analysis of poly(A) and/or mRNA: (a) renewing of the hanging mercury drop electrode surface, (b) introducing of sample (5 ␮l) containing poly(A) and/or mRNA on parafilm, (c) adsorbing of poly(A) and/or mRNA in a drop onto the HMDE surface at open circuit, (d) rinsing electrode in water of ACS purity, (e) measuring in supporting electrolyte. (B) Scheme of poly(A) isolation by using of paramagnetic microparticles: (a) washing of the particles, adding of hybridization solution and a sample; (b) denaturation of hybridized nucleic acids chains at higher temperature; (c) forcing of the particles by magnetic field; (d) electrochemical detection an isolated nucleic acids.

Fig. 2. Optimization of CV experimental parameters: the dependence of peak height on (A) scan rate, (B) time of accumulation and (C) concentration of poly(A). Concentration of poly(A): 100 ␮g/ml.

Table 1 Analytical parameters of poly(A) detection. Data

Peak potential (V)a

Calibration curve (nA)

R2

Poly(A)e Poly(A) 120s f , g Poly(A)60s f , g Poly(A)30s f , g

−1.4 −1.4 −1.4 −1.5

I = 1.204c + 888.5 I = 56.91c + 7.14 I = 36.89c + 4.52 I = 19.86c + 6.67

0.9920 0.9973 0.9967 0.9917

± ± ± ±

0.1 0.1 0.2 0.2

Linear dynamic range (␮g/ml) 0.4–25 0.2–25 0.2–25 0.2–25

LOD (ng/ml)b 100 1 5 10

LOQ (ng/ml)c 333 3 17 33

R.S.D. (%)d 5.5 3.9 4.8 6.8

I: peak current (in calibration curve). c Poly(A) concentration (in calibration curve). a Measured vs. Ag/AgCl/3 M KCl electrode. b Limit of detection estimated (3 signal/noise, S/N) was calculated according to Long and Winefordner [56], whereas N was expressed as standard deviation of noise determined in the signal domain unless stated otherwise. c Limit of quantification estimated as (10 S/N) [56]. d Relative standard deviation. e Poly(A) was measured by AdTS CV, time of accumulation 120 s. f Poly(A) was measured by AdTS SWV, time of accumulation as superscript. g Number of measurement (n = 5).

140

406

D. Huska et al. / Talanta 79 (2009) 402–411

3.1.2. Electrochemical behaviour of poly(A) investigated by adsorptive transfer technique in connection with square wave voltammetry Cyclic voltammetry is the most widely used technique for acquiring qualitative information about electrochemical reactions; however, it suffers from insufficient sensitivity and high detection limits. Therefore we selected much more sensitive method called square wave voltammetry (SWV) [51]. The comparison of poly(A) signals measured by CV and SWV is shown in Fig. 3A. The signal measured by CV was shifted for more than 50 mV to positive potentials. From the analytical point of view SWV signal was approximately two times higher compared to CV signal. Based on SW voltammetric analyses of DNA the highest current response was measured at 260 Hz [43,51]. We investigated the influence of frequency on poly(A) SWV signal (Fig. 3B). The highest signal was determined at a frequency of 280 Hz. Under higher frequencies the signal rapidly decreased. The difference between previously published value (260 Hz) and the optimized ones (280 Hz) can be probably associated with the influence of nucleic acids sequence. The dependence of peak height on accumulation time had similar trend compared to CV analyses with maximum measured at 200 s (Fig. 3C). Under higher accumulation times the peak height decreased. Further we focused our attention on studying the effect of temperature of supporting electrolyte on poly(A) signal. The highest peak was determined at 35 ◦ C. Temperature higher than 40 ◦ C resulted to the progressive destabilization of poly(A) molecule on the electrode surface. The increasing temperature enhances probability of irregular bases pairing (Fig. 3D). The significant role in nucleic acids detection also plays pH of supporting electrolyte. It clearly follows from the results obtained that the highest response

was measured in the presence of acetate buffer pH 4.6 (Fig. 3E). This phenomenon can be associated with the protonization of poly(A) molecule. Under the optimized conditions (frequency 280 Hz, accumulation time 200 s, supporting electrolyte and its temperature: acetate buffer 4.6 and 35 ◦ C) we investigated the dependence of peak height on poly(A) concentration within the range from 0.02 to 12 ␮g/ml (Fig. 3F). The dependence was proportional to poly(A) concentration according to the equation y = 56.91x + 7,14, R2 = 0.9973 with relative standard deviation 3.9% (n = 5). The detection limit of poly(A) was estimated as 1 ng/ml (2.5 pM). The other analytical parameters are shown in Table 1. 3.2. Semi-automated isolation of nucleic acids by using of paramagnetic particles Analysis of nucleic acids represents still challenge for analytical chemistry and biochemistry especially in the field of RNA detection or determination of specific DNA sequences. From various types of RNAs mRNA is important due to the fact that relates with gene activity; however, their isolation is still laborious and time consuming. We utilized paramagnetic particles with homo-thymidine chain anchored on their surface for isolation of mRNA as it is shown in Fig. 1B. To enhance effectiveness and repeatability of isolation of nucleic acid automated approach for rinsing and hybridizing was proposed. The whole process is shown in Fig. 4. Paramagnetic particles (10 ␮l) are transferred with solution in which they are kept to a test-tube (A1). After this step the test-tube is placed to magnetic stand that separates paramagnetic particles from the solution of storage (A2). The solution is then pipetted away and 20 ␮l of washing solution (phosphate buffer I) is added (A3). Further the

Fig. 3. (A) Cyclic and square wave voltammograms of poly(A). Optimization of SWV experimental parameters: the dependence of peak height on (B) frequency, (C) time of accumulation, (D) temperature of supporting electrolytes, (E) pH of acetate buffer and (F) concentration of poly(A). Concentration of poly(A) was 10 ␮g/ml except (F).

141

D. Huska et al. / Talanta 79 (2009) 402–411

407

Fig. 4. Scheme of semi-automated isolation of poly(A): (A) rinsing before hybridization, (B) hybridization, (C) rinsing after hybridization, (D) denaturation and (E) detection.

test-tube is moved from magnetic stand and shortly shook in the hands so that the paramagnetic particles are equally dispersed in washing solution (A4). After this step the washing process is repeated (A5–A6). The washing with apparatus multi-spin MSC3000, in which the centrifugation and shaking can be changed, follows. Shaking was set to level hard and lasted for 20 s; centrifugation proceeded at centrifugal force 285 g for 1 s (A7). Steps nos. A2–A7 are three times repeated. After paramagnetic particles being washed they are ready for nucleic acid isolation (process of hybridization). When the washing solution is removed (A8–B9), the hybridization solution is added to the paramagnetic particles. Total volume of the hybridization solution with the sample was 30 ␮l

(B10). The hybridization was proceeding on apparatus multi-spin MSC-3000 for the 40 min. The settings were as follows: 20 s of shaking (level soft) and centrifugation for 1 s at 285 g (B11). After the hybridization, the washing steps nos. A2–A7 were repeated three times. To the washed paramagnetic particles with bounded poly(A) phosphate buffer II (30 ␮l) was added (A13). Then the test-tube was placed in the Thermomixer 5355. Denaturation was carried out at 85 ◦ C for 5 min (C14). Under heat treatment poly(A) is released from the particles. After this step, paramagnetic particles were forced using magnetic stand and the solution containing only mRNA was transferred into new test-tube (C15–C16). The solution is subsequently analysed (D).

Fig. 5. Optimization of hybridization: (A) the dependence of hybridization time on poly(A) peak height, (B) the dependence of NaCl concentration on poly(A) peak height and (C) the dependence of temperature on poly(A) peak height.

142

408

D. Huska et al. / Talanta 79 (2009) 402–411

3.2.1. Hybridization of poly(A) on paramagnetic particles Hybridization of poly(A) to homo-thymine chains anchored on the surface of paramagnetic particles is the most important part of the whole isolation. Therefore we optimized experimental conditions to reach the highest yield of poly(A). There are many factors that affect the process of hybridization. The first parameter we investigated was length of hybridization. We found that the total amount of isolated poly(A) enhanced with increasing hybridization time. For the above-suggested semi-automated way of isolation (Fig. 4) the most suitable time for the most effective hybridization varied between 30 and 40 min (Fig. 5A). The yield of poly(A), which was defined as “isolated concentration of poly(A)”/“given concentration of poly(A)”, was approximately 50% (n = 15). The ionic strength also markedly affects hybridization process. To mimic the influence of ionic strength on the hybridization we used NaCl. The highest peak was determined in the presence of 0.5 M NaCl (Fig. 5B). The differences in peaks measured in the presence of tested NaCl concentrations were not higher than 35%. Process of hybridization is also affected by temperature. In our experimental design it was possible to test two temperatures: 15 and 30 ◦ C. Based on our results these two temperatures had no effect on the hybridization process (Fig. 5C). Further we attempted to evaluate how the automation and optimization steps were effective (Fig. 6). The white columns show poly(A) (10, 50 and 90 ␮g/ml) detected without previous isolation. The development of peak heights corresponds to the typical concentration dependence shown in Fig. 3E. If we used the experimental procedure described by Palecek for poly(A) isolation [29], the yield was low (15%) with relative standard deviation 8%. Under the optimized conditions the yield of isolation enhanced up to 60% with relative standard deviation 10%. Using semi-automated way of isolation and under optimized conditions the yield was about 75% with the relative standard deviation below 6%. It clearly follows from the results obtained that automation step considerably reduced errors made by hand operating and thus enhanced yield of the isolation.

the patients. S100B protein might be one of such markers [52–54]. Moreover, changes in gene expression profile a set of genes transcripts for cell cycle control, inflammation, cell proliferation and oxygen free radical scavenger proteins, growth inhibitory factor; metallothionein-III, p53 antigen, p53-induced protein, interleukins, TNF receptor associated death domain, and FAS soluble protein was shown in patients with traumatic brain injury [54]. To follow these changes sample of pure mRNA is needed. Not only the level of mRNA can be considered as one of the markers of traumatic brain injury, but also the isolated mRNA can be used for more specialized processing to detect specific sequence of a gene associated with traumatic brain injury. Moreover, the enhancing of mRNA level in few hours after traumatic brain injury was discussed [55]. The suggested and optimized methods for poly(A) isolation and detection was utilized for the analysis of brain tissues of six patients with traumatic brain injury. Traumatic damaging of brain tissue measured by nuclear magnetic resonance (abnormal signals are white-highlighted) is shown in inset in Fig. 7. mRNA was successfully isolated from all analysed samples by the semi-automated above-described method. Their quantity was determined by SWV. Well-developed peaks about −1.6 V were observed in the SW voltammograms shown in Fig. 7A. The total amount of the isolated mRNA varied from 40 to 760 ␮g of mRNA per g of brain tissue (Fig. 7B). Based on the spikes of poly(A) to real samples we investigated the influence of matrix on the electrochemical response of isolated mRNA. The recovery was within the interval from 94 to 115% (Table 2).

3.2.2. mRNA separation from samples of patients with traumatic brain injury In many cases of traumatic injury there are no suitable markers available for the monitoring of brain damage and health state of

Fig. 6. The yield of isolation of various initial concentrations of poly(A) (10, 50 and 90 ␮g/ml).

Fig. 7. mRNA separation from patients with traumatic brain injury. (A) Typical SW voltammograms of eluates (20 ␮l) obtained from the brain tissues. (B) The content of the isolated mRNA in brain tissues obtained from patients; inset: traumatic damaging of brain tissue measured by nuclear magnetic resonance.

143

D. Huska et al. / Talanta 79 (2009) 402–411

409

Table 2 Detect mRNA vs. brain tissues. Samplea

Peak current (nA)b

Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6

280 205 100 1060 220 500

a b c d

± ± ± ± ± ±

Peak potential (mV)c

Recovery (%)d −1.56 −1.59 −1.58 −1.58 −1.56 −1.55

20 50 5 20 10 20

± ± ± ± ± ±

0.02 0.04 0.03 0.02 0.03 0.02

105.5 98.7 94.6 110.8 115.0 108.8

Each sample was measured in triplicates. The height of SWV signal after baseline correction (GPES 4.9, EcoChemie, Netherlands). Measured vs. Ag/AgCl/3 M KCl electrode. Addition of poly(A) (10 ␮g/ml) to a sample after isolation.

3.3. Fully automated separation of nucleic acids by using of paramagnetic particles In the following experiments we have been carried out with fully automated isolation of poly(A) by using a robotic device epMotion (Fig. 8). Pipetting of liquids and moving of PCR plates provide x, y, z moving arm controlled by a microprocessor (Fig. 8A). The work sequence is shown in Fig. 8B. The eluate obtained is analysed electrochemically. For our purposes the following sequence was proposed: (i) paramagnetic microparticles (10 ␮l) are pipetted into the PCR plate; (ii) a washing cycle is three times repeated (50 ␮l); (iii) the sample (poly(A), (10 ␮l) and hybridization solution (30 ␮l) are pipetted into PCR plates with paramagnetic microparticles; (iv) 15 min long hybridisation is carried out at 25 ◦ C; (v) a washing cycle is three times repeated (50 ␮l). The PCR plate is

later on moved on thermostated position, where the denaturation of bound nucleic acid chain takes place. The yield of poly(A) separation (25 ␮g/ml) was 40% with R.S.D. 6.5% (n = 10). Fully automatic process leads to timesavings and, in particular, reduces experimental errors. Among the technical problems, which are still associated with the use of this procedure, the evaporation of the sample analysed belongs. We have been investigated the isolation of poly(A) on DBT and/or ROCHE magnetic microparticles by using of the fully automated technique. The yield of poly(A) isolated by DBT microparticles was approximately 40%. Using these microparticles the dependence of peak height on concentration of isolated poly(A) (0–100 ␮g/ml) was investigated and is shown in Fig. 9A. In inset of this figure, strictly linear part of this dependence is shown. The yield of poly(A) isolated by ROCHE microparticles was approximately 25%. Moreover the isolated amount of

Fig. 8. Scheme of fully automated instrument for isolation of mRNA. (A) The arrangement of working tools. Electrochemical analyser is off-line connected. (B) Sequence of steps for the analysis of real samples.

144

410

D. Huska et al. / Talanta 79 (2009) 402–411

Fig. 9. (A) The dependence of height of poly(A) after its isolation by using fully automated instrument; inset: the linear part of this dependence. (B) Typical SW voltammograms of extracts from tissues of plants treated with cadmium(II) ions. (C) Photographs of maize plants treated with cadmium(II) ions (0, 50 and 100 ␮M). (D) The content of the isolated mRNA from roots extracts. *Differences with p < 0.05 were considered significant.

poly(A) was not proportional to the initial concentration of these molecules. The method of fully automated isolation of mRNA was utilized for the analysis of tissues of maize plants exposed to cadmium(II) ions. Roots of the plants treated with particular concentration of cadmium(II) ions were sampling for five days. mRNA was isolated from the extract prepared from all roots belonging to one particular concentration of heavy metal. Typical voltammograms of the isolated mRNA are shown in Fig. 9B. In all samples it was possible to detect mRNA. Photographs of maize plants treated with cadmium(II) ions are shown in Fig. 9C. It follows from the photographs that plants are loosing weight in roots, leaf surface is reduced and content of chlorophyll is decreased with the increasing concentration of cadmium(II) ions and time of the exposition. All of these negative processes lead to the gradual exhaustion of a plant. We found that the average level of mRNA in samples decreased slightly in the lower concentrations applied. Since the applied concentration of 25 ␮M, the significant increase of mRNA levels was observed (Fig. 9D). The dramatic increase in mRNA levels can be associated with the increased metabolic activity in plants of maize to overcome the adverse effects of heavy metal ions. 4. Conclusion We succeeded in suggestion, optimization and automation of the method for mRNA isolation using paramagnetic microparticles. The main advantage of our method is its rapidity. The isolation of mRNA from six samples per run is not longer than 2.5 h. The proposed method was tested on brain tissues and maize roots. Acknowledgement Financial support from the grant GACR 102/08/1546 and KAN208130801 is highly acknowledged. References [1] M.J. Archer, B.C. Lin, Z. Wang, D.A. Stenger, Anal. Biochem. 355 (2006) 285.

[2] L. Cler, D.W. Bu, C. Lewis, D. Euhus, Mol. Cell. Probes 20 (2006) 191. [3] S. Dubus, J.F. Gravel, B. Le Drogoff, P. Nobert, T. Veres, D. Boudreau, Anal. Chem. 78 (2006) 4457. [4] J.S. Ki, K.B. Chang, H.J. Roh, B.Y. Lee, J.Y. Yoon, G.Y. Jang, J. Biosci. Bioeng. 103 (2007) 242. [5] C. Becker, M. Hodenius, G. Blendinger, A. Sechi, T. Hieronymus, D. MullerSchulte, T. Schmitz-Rode, M. Zenke, J. Magn. Magn. Mater. 311 (2007) 234. [6] Z.J. Cao, Z.X. Li, Y.J. Zhao, Y.M. Song, J.Z. Lu, Anal. Chim. Acta 557 (2006) 152. [7] C.H. Chiou, Y.Y. Huang, M.H. Chiang, H.H. Lee, G.B. Lee, Nanotechnology 17 (2006) 1217. [8] N. Jaffrezic-Renault, C. Martelet, Y. Chevolot, J.P. Cloarec, Sensors 7 (2007) 589. [9] D.K. Kim, Y. Zhang, W. Voit, K.V. Rao, M. Muhammed, J. Magn. Magn. Mater. 225 (2001) 30. [10] T. Kinoshita, S. Seino, Y. Mizukoshi, T. Nakagawa, T.A. Yamamoto, J. Magn. Magn. Mater. 311 (2007) 255. [11] E. Palecek, M. Fojta, Talanta 74 (2007) 276. [12] S.W. Yeung, I.M. Hsing, Biosens. Bioelectron. 21 (2006) 989. [13] M.A.M. Gijs, Microfluid Nanofluid 1 (2004) 22. [14] R. Heer, M. Eggeling, J. Schotter, C. Nohammer, R. Pichler, M. Mansfeld, H. Bruckl, J. Magn. Magn. Mater. 311 (2007) 244. [15] I.M. Hsing, Y. Xu, W.T. Zhao, Electroanalysis 19 (2007) 755. [16] L. Lagae, R. Wirix-Speetjens, C.X. Liu, W. Laureyn, G. Borghs, S. Harvey, P. Galvin, H.A. Ferreira, D.L. Graham, P.P. Freitas, L.A. Clarke, M.D. Amaral, IEE Proc. Circ. Dev. Syst. 152 (2005) 393. [17] N. Minc, C. Futterer, K. Dorfman, A. Bancaud, C. Gosse, C. Goubault, J.L. Viovy, Anal. Chem. 76 (2004) 3770. [18] O. Mykhaylyk, D. Vlaskou, N. Tresilwised, P. Pithayanukul, W. Moller, C. Plank, J. Magn. Magn. Mater. 311 (2007) 275. [19] P.I. Nikitin, P.M. Vetoshko, T.I. Ksenevich, J. Magn. Magn. Mater. 311 (2007) 445. [20] L. Pichl, A. Heitmann, P. Herzog, J. Oster, H. Smets, V. Schottstedt, Transfusion 45 (2005) 1106. [21] A. Revyakin, R.H. Ebright, T.R. Strick, Nat. Met. 2 (2005) 127. [22] A.F. Ngomsik, A. Bee, M. Draye, G. Cote, V. Cabuil, C. R. Chim. 8 (2005) 963. [23] T. Lund-Olesen, M. Dufva, M.F. Hansen, J. Magn. Magn. Mater. 311 (2007) 396. [24] O. Lunov, S. Bespalova, V. Zablotskii, J. Magn. Magn. Mater. 311 (2007) 162. [25] C.J. Xu, S.H. Sun, Polym. Int. 56 (2007) 821. [26] C.H. Yu, C.C.H. Lo, K. Tam, S.C. Tsang, J. Phys. Chem. C 111 (2007) 7879. [27] T. Matsunaga, M. Kawasaki, X. Yu, N. Tsujimura, N. Nakamura, Anal. Chem. 68 (1996) 3551. [28] M. Fojta, L. Havran, S. Billova, P. Kostecka, M. Masarik, R. Kizek, Electroanalysis 15 (2003) 431. [29] E. Palecek, S. Billova, L. Havran, R. Kizek, A. Miculkova, F. Jelen, Talanta 56 (2002) 919. [30] E. Palecek, R. Kizek, L. Havran, S. Billova, M. Fojta, Anal. Chim. Acta 469 (2002) 73. [31] V.C. Diculescu, A.M.C. Paquim, A.M.O. Brett, Sensors 5 (2005) 377. [32] M. Fojta, L. Havran, R. Kizek, S. Billova, Talanta 56 (2002) 867. [33] R. Kizek, L. Havran, M. Fojta, E. Palecek, Bioelectrochemistry 55 (2002) 119. [34] O. Korbut, M. Buckova, J. Labuda, P. Grundler, Sensors 3 (2003) 1.

145

D. Huska et al. / Talanta 79 (2009) 402–411 [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47]

J. Wang, A.N. Kawde, A. Erdem, M. Salazar, Analyst 126 (2001) 2020. T. Murashige, F. Skoog, Physiol. Plant 15 (1962) 473. E. Palecek, Collect. Czech. Chem. Commun. 25 (1960) 2283. E. Palecek, Naturwissenschaften 45 (1958) 186. E. Palecek, Biochem. Moscow 25 (1960) 619. R. Mikelova, L. Trnkova, F. Jelen, V. Adam, R. Kizek, Electroanalysis 19 (2007) 348. L. Trnkova, F. Jelen, J. Petrlova, V. Adam, D. Potesil, R. Kizek, Sensors 5 (2005) 448. L. Trnkova, F. Jelen, I. Postbieglova, Electroanalysis 18 (2006) 662. L. Trnkova, R. Kizek, O. Dracka, Electroanalysis 12 (2000) 905. L. Trnkova, R. Kizek, O. Dracka, Bioelectrochemistry 55 (2002) 131. L. Trnkova, I. Postbieglova, M. Holik, Bioelectrochemistry 63 (2004) 25. A.M.O. Brett, A.M. Chiorcea, Electrochem. Commun. 5 (2003) 178. F.C. Abreu, M.O.F. Goulart, A.M.O. Brett, Biosens. Bioelectron. 17 (2002) 913.

[48] [49] [50] [51] [52] [53] [54] [55] [56]

411

D.F. Colgan, J.L. Manley, Genes Dev. 11 (1997) 2755. J.L. Manley, Biochim. Biophys. Acta 950 (1988) 1. N.J. Proudfoot, A. Furger, M.J. Dye, Cell 108 (2002) 501. M. Tomschik, F. Jelen, L. Havran, L. Trnkova, P.E. Nielsen, E. Palecek, J. Electroanal. Chem. 476 (1999) 71. M. Rothermundt, M. Peters, J.H.M. Prehn, V. Arolt, Microsc. Res. Tech. 60 (2003) 614. D. Vajtr, R. Prusa, J. Kukacka, L. Houstava, F. Samal, J. Pachl, J. Pazout, Cesk. Slov. Neurol. Neurochir. 70 (2007) 515. J. Kukacka, D. Vajtr, D. Huska, R. Prusa, L. Houstava, F. Samal, V. Diopan, K. Kotaska, R. Kizek, Neuroendocrinol. Lett. 27 (2006) 116. S.A. Dutcher, B.D. Underwood, P.D. Walker, F.G. Diaz, D.B. Michael, Neurol. Res. 21 (1999) 234. G.L. Long, J.D. Winefordner, Anal. Chem. 55 (1983) A712.

146

5.4.6 Automatická izolace nukleových kyselin pomocí paramagnetických částic s elektrochemickou detekcí Studium exprese genů vyţaduje izolaci mRNA z biologické matrice. V současnosti se stále hledají a vyvíjejí nové techniky, které by byly jednoduché, efektivní a rychlé. V této práci jsme navrhli postup semiautomatické a automatické izolace mRNA pomocí paramagnetických mikro částic s elektrochemickou kvantifikací. Navrţenou metodu jsme pak aplikovali na studium transkriptomu u rostlin kukuřice seté (Zea mays L.) ovlivněných ionty kadmia. Izolace se zakládala na paramagnetických částicích, které měli na svůj povrch ukotven oligonukleotidový řetězec sloţený z tyminů. Naproti tomu kaţdá mRNA má na jednom svém konci sekvenci aţ 250 adeninů nazývanou jako polyadenilová čepička. Díky tomu lze poměrně jednoduše z biologické matrice zjistit aktuální mnoţství transkriptomu a tím i celkovou expresi. Nejdříve byla provedena celková optimalizace navrţeného postupu a zjištění co nejideálnějších podmínek na polyadenilové (polyA) sekvenci, která nám poslouţila jako standardní vzorek simulující budoucí mRNA izolovanou z reálné biologické matrice. Hlavními podmínkami, které byly studovány, byla doba, teplota a iontová síla a pH, při které probíhá vazba polyA sekvence na paramagnetické částice. Optimalizovat podmínky jsme museli i u elektrochemické detekce a to především dobu akumulace jiţ získané polyA na povrch rtuťové elektrody. Pro automatizaci postupu byla vyuţita automatická pipetovaní stanice, do které byl na zakázku zabudován magnetický stojan umoţňující pracovat s paramagnetickými částicemi. Pro izolaci byl vytvořen a odzkoušen program řídící jednotlivé kroky stanice při izolaci. Teprve po odzkoušení celého postupu jsme mohli přistoupit na testování na reálných vzorcích. Kvantifikovali jsme mnoţství transkriptomu u rostlin kukuřice seté pěstovaných hydroponicky z přítomnosti 0, 5, 10, 25, 50 a 100 µM koncentraci kademnatých iontů po dobu 5 dnů. U vzorků byla z kořenů izolována mRNA a následně stanovena pomocí elektrochemie. Téměř dvojnásobný nárůst transkriptomu oproti kontrole byl detekován u rostlin kultivovaných při koncentraci kademnatých iontů 25 µM. Přítomnost vyšších koncentrací kademnatých iontů způsobila zvýšení hladiny transkriptomu oproti kontrole aţ 6 násobně. Tento fakt lze vysvětlit snahou organismu odolat stresovému faktoru a dochází tak ke zvýšení metabolické aktivity. V tomto článku jsme navrhli, zrealizovali a odzkoušeli systém pro izolaci a detekci celkové mRNA.

147

5.5 Studium rostlinného transkriptomu pomocí paramagnetických částic a elektrochemických metod 5.5.1 Vědecký článek VI

Microfluidic robotic device coupled with electrochemical sensor field for handling of paramagnetic micro-particles as a tool for determination of plant mRNA.

Huska, D.; Adam, V.; Babula, P.; Trnkova, L.; Hubalek, J.; Zehnalek, J.; Havel, L.; Kizek, R., Microchimica Acta 2011, 173 (1-2), 189-197 IF = 2.578 Podíl autora Húska D.: 50 % textové části práce a 60% experimentální práce

148

Microchim Acta (2011) 173:189–197 DOI 10.1007/s00604-011-0545-z

ORIGINAL PAPER

Microfluidic robotic device coupled with electrochemical sensor field for handling of paramagnetic micro-particles as a tool for determination of plant mRNA Dalibor Huska & Vojtech Adam & Petr Babula & Libuse Trnkova & Jaromir Hubalek & Josef Zehnalek & Ladislav Havel & Rene Kizek

Received: 13 July 2010 / Accepted: 5 January 2011 / Published online: 21 January 2011 # Springer-Verlag 2011

Abstract The expression of genes responsible for the biosynthesis of stress proteins corresponds to the exposition of an organism to abiotic and/or biotic stress. We utilize two types of paramagnetic particles for isolation of total mRNA from early somatic embryos of Norway Spruce (Picea abies /L./ Karst.) and maize plants (Zea mays L.) treated with cadmium(II) ions. The paramagnetic particles Electronic supplementary material The online version of this article (doi:10.1007/s00604-011-0545-z) contains supplementary material, which is available to authorized users. D. Huska : V. Adam : J. Zehnalek : R. Kizek (*) Department of Chemistry and Biochemistry, Mendel University, Zemedelska 1, CZ-613 00 Brno, Czech Republic e-mail: [email protected] D. Huska : L. Havel Department of Plant Biology, Mendel University, Zemedelska 1, CZ-613 00 Brno, Czech Republic P. Babula Department of Natural Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackeho 1-3, CZ-612 42 Brno, Czech Republic L. Trnkova Department of Chemistry, Faculty of Science, Masaryk University, Kotlarska 2, CZ-611 37 Brno, Czech Republic J. Hubalek Department of Microelectronics, Faculty of Electrical Engineering and Communication, Brno University of Technology, Udolni 53, CZ-602 00 Brno, Czech Republic

were evaluated for analysis of real samples, and polyadenine was used as a model mRNA. Various approaches (from non-automatic to fully automatic) were tested in terms of handling the particles. Keywords Electrochemical detection . Microfluidics . Environmental stress . Cadmium ions . Paramagnetic particles

Introduction An anthropogenic activity directly or indirectly influences not only organism itself, but also the whole populations and/or communities. A technological development contributed to improving of standard living also brought a plenty of negative effects on ecosystems [1]. One of these effects is pollution of air, soil, and water by various types of wastes and undesirable substances such as heavy metals and their compounds. Heavy metals (ρ>5 g.cm−3) are one of the most toxic and undesirable compounds polluting agricultural products [2, 3]. They are also natural components of the Earth’s crust and cannot be degraded or destroyed. Heavy metals are dangerous because they tend to bioaccumulate. The soil with high heavy metals content poses a serious threat to plants. Toxic effects of heavy metal ions on plants are related to damaging of photosynthetic system, inhibiting activity of key enzymes for plant metabolism and others [4]. Increasing heavy metal ions concentration in plant tissues results in activation of protective mechanisms, mainly in synthesis of cysteine-rich peptides as glutathione [5, 6] or phytochelatins [7–10] and/or metallothionein like proteins [11–13]. Moreover, plants demonstrating higher tolerance to heavy metals can be employed in phytoremediation technologies [10, 14–16].

149

190

All these stress induced processes are closely associated with changes in homeostasis causing subsequent synthesis of signalling compounds e.g. salicylic acid, jasmonic acid, methyljasmonate and others [17–22]. A signalling pathway triggers specific cascades leading to activation of transcription factors. An activated transcription factor is bounded into promoter of a stress gene to start transcription. Transcribed mRNA molecules are transported from nucleus to cytoplasm, where a stress protein stimulating the resistance against stress factor is translated. To investigate the stress cell response, mRNA and/or translated protein detection is needed [23]. The most commonly used method for detection of mRNA is polymerase chain reaction (PCR) [24]. However, prior to detection of mRNA by PCR, an isolation of sufficient amount of mRNA without contamination by other nucleic acids is unavoidable [25–33]. The main aim of this study was to utilize paramagnetic particles for total mRNA isolation and quantification in early somatic embryos of Norway Spruce (Picea abies /L./ Karst.) and maize plants (Zea mays L.) treated with cadmium(II) ions.

Experimental Chemicals, material and pH measurements Cultivation media were prepared using plant cell culture tested chemicals purchased from Duchefa Biochemie BV (The Netherlands, www.duchefa.com). All chemicals of ACS purity used and parafilm were purchased from Sigma Aldrich Chemical Corp. (Sigma-Aldrich, USA, www. sigmaaldrich.com) unless noted otherwise. Synthetic polyadenylic acid (poly(A), Sigma-Aldrich) was used. Stock standard solution of poly(A) (100 μg.mL−1) was prepared from lyophilized poly(A) (0.5 mg.mL−1, Mr=400000) with water of ACS purity and stored in dark at −20 °C. The concentration of poly(A) was determined spectrophotometrically at 260 nm using spectrometer Spectronic Unicam (England, www.spectronic.co.uk). Deionised water underwent demineralization by reverse osmosis using the instrument Aqua Osmotic 02 (Aqua Osmotic, Tisnov, Czech Republic, www.aquaosmotic.cz) and subsequently purified using Millipore RG (18 MΏ, Millipore Corp., USA, www. millipore.com) called MiliQ water. The pH value was measured using inoLab Level 3 (Wissenschaftlich-Technische Werkstatten GmbH; Weilheim, Germany, www.wtw.com).

D. Huska et al.

with three electrodes. A hanging mercury drop electrode (HMDE) with a drop area of 0.4 mm2 was employed as the working electrode. An Ag/AgCl/3 M KCl electrode served as the reference electrode. Glassy carbon electrode was used as the auxiliary electrode. For smoothing and baseline correction, the software GPES 4.9 supplied by EcoChemie was employed. Square wave voltammetric (SWV) measurements were carried out in the presence of acetate buffer pH 4.6 (35 °C). SWV parameters: potential step 5 mV, frequency 280 Hz, accumulation time 200 s [34]. The analysed samples were deoxygenated prior to measurements by purging with argon (99.999%) saturated with water for 120 s. The temperature of supporting electrolyte was maintained by the flow electrochemical cell coupled with thermostat JULABO F12/ED (Julabo Labortechnik GmbH, Germany, www.julabo.de). mRNA isolation Isolation of Poly(A) and mRNA was carried out using paramagnetic particles Dynabeads Oligo (dT)25 (Invitrogen, USA, www.invitrogen.com) or MAGNa (Roche, France, www.roche.fr) and magnetic stand Dynal Magnetic Particle Concentrator-S supplied by Dynal A.S (Norway, www.dynal. no). All experiments with paramagnetic particles were performed in RNA/DNA UV cleaner box UVT-S-AR (Biosan, Latvia, www.biosan.lv). For centrifuging and vortexing of a sample, multi-spin MSC-3000 centrifuge (Biosan) placed in UV cleaner box was used. Denaturation was carried out at 85 °C using the Thermomixer 5355 Comfort/Compact (Eppendorf, Germany, www.eppendorf.com). The buffers used in our experiments were as follows—a) phosphate buffer I: 0.1 M NaCl+0.05 M Na2HPO4 + 0.05 M NaH2PO4; b) phosphate buffer II: 0.2 M NaCl+ 0.1 M Na2HPO4 +0.1 M NaH2PO4; c) acetate buffer: 0.2 M CH3COOH+0.2 M CH3COONa. Hybridization of nucleic acids The hybridisation process was optimised previously [34]. Briefly, the optimal composition of hybridization solution was as follows: 100 mM Na2HPO4 +100 mM NaH2PO4, 0.5 M NaCl, 0.6 M guanidinium thiocyanate, 0.15 M Trizma base adjusted by HCl on pH of 7.5. Time of hybridization was 40 min. [34]. Plants cultivation

Stationary electrochemical measurements Electrochemical measurements were performed with AUTOLAB PGS30 Analyzer (EcoChemie, Netherlands, www.ecochemie.nl) connected to VA-Stand 663 (Metrohm, Switzerland, www.metrohm.com), using a standard cell

In vitro cultured maize plants Maize (Zea mays L.) F1 hybrid Gila was used in our experiments. After 7 days long germination, maize seedlings were placed into vessels containing Murashige-Skooge medium [35] with (0, 5, 10, 25, 50 and 100 μM) or without addition of CdCl2 and

150

Microfluidic robotic device coupled with electrochemical sensor

cultivated in Versatile Environmental Test Chamber (MLR-350 H, Sanyo, Japan, www.sanyo.com) for 5 days. Each time, four plants were harvested at certain time intervals (1, 2, 3, 4 and 5 days) during the experiment, and their roots were rinsed three times in distilled water and 0.5 M EDTA. In addition, each harvested plant was divided into shoots and roots. Fresh weight of the samples was measured immediately after the rinsing by using a Sartorius scale. Plant embryos The culture of early somatic embryos (ESEs) of Norway spruce (Picea abies /L./ Karst.) clone 2/32 [36] was used in our experiments and cultivated according to [37–39]. The ESE clusters of clone 2/32 were cultivated on a modified LP medium with an addition of cadmium chelate (Cd-EDTA [40]) in concentrations of 50, 100, 250 and 500 μM. Field experiment Maize (Zea mays L.) F1 hybrid Gila was used in our experiments. After 7 days long germination, maize seedlings were placed into vessels containing tap water and cultivated in Versatile Environmental Test Chamber (MLR-350 H, Sanyo) for 21 days. Thirty days old plants were placed into pots containing tap water with or without addition of 10 μM CdCl2 in vegetational hall in July 2008. The plants were grown for 21 days. Each time, four plants were harvested at certain time intervals (7, 12, 17 and 21 days) during the experiment, and their roots were rinsed three times in distilled water and 0.5 M EDTA. In addition, each harvested plant was divided into shoots and roots. Details for cultivation of the biological material can be found in Electronic Supplementary Material (ESM).

Detection of chlorophyll fluorescence Detection of chlorophyll fluorescence was carried out on homemade instruments from Department of Microelectronics, Brno University of Technology, Czech Republic. The high sensitivity of the measurement is performed by the photon counter as detector, which is the main part of the system. Wavelength of light-emitting diodes (LED) was 560 nm. LEDs grouped around the photon counter window to circle perform the source of the light (50 mm2). The LEDs are driven by microcontroller, which also counts the pulses from the photon counter. The microcontroller communicates with personal computer through USB. The software with the system does short light exposition followed by counting of pulses from the detector for several seconds. The absolute dark background has to be assured to obtain high sensitivity at level of a few photons.

191

Fully automated isolation of mRNA Fully automated isolation was carried out on automated pipetting system epMotion 5075 (Eppendorf, Germany). The position of B4 is a magnetic separator (Promega). The positions of C1 and C4 can be thermostated (Epthermoadapter PCR96). The pipetting provides a robotic arm with adapters (TS50, TS300, TS1000) and Gripper (TG-T). The samples are placed in the position B3 in adapter Ep0.5/1.5/2 mL. Module Reservoir is located in the position B1, where washing solutions and waste are available. The device is controlled by the epMotion control panel. The tips are located in the A4 (ePtips 50), A3 (ePtips 300) and A2 (ePtips 1000) positions. PCR 96 plates are used (Fig. 1). Descriptive statistics Data were processed using MICROSOFT EXCEL® (USA, www.microsoft.com). Results are expressed as mean ± standard deviation (S.D.) unless stated otherwise.

Results and discussion mRNA isolation For studying of gene expression in plants exposed to various stress factors, high quality and chemically unmodified nucleic acids isolation are necessary. Nowadays, the attention is mainly paid to isolation of highly pure nucleic acids. Not only qualitative isolation, but also quantitative determination of nucleic acid makes challenge for bioanalytical chemistry. Using the classic way isolation (phenol:chloroform), all types of RNAs are obtained. The obtained RNA must be converted using reverse transcription to cDNA prior to the consequent experiments. The other way of RNA preparation is addition of the appropriate RNA primers and looking for the target mRNA sequence. Isolation of total mRNA using the standard procedure is practically impossible. Therefore, microparticles allowing isolation of total mRNA or even a specific sequence bring new possibilities to monitor environmental stress or diagnosis of serious illness. In this study, two methods of mRNA isolation from biological samples were compared. Plant tissues were homogenised according to procedure published by us, which was based on deep-freezing of the tissues by liquid nitrogen and pulverization of them in grinding mortar with addition of guanidinium thiocyanate as inhibitor of RNAse [41]. Sample prepared like this was divided into two equal parts; each part was used for mRNA isolation by different procedure. Process of mRNA micro-isolation (total volume did not exceed 30 μL). To processed sample, paramagnetic

151

192

D. Huska et al.

A

magnetic beads

a

washing

biological sample

c

b

hybridization

washing

d

e

mRNA separation

mRNA binding on magnetic beads

B

magnet

magnet Elution of bounded mRNA

f

magnet

85 C

heating

Fig. 1 Simplified scheme of mRNA isolation from plant sample. a Automated process of isolation of mRNA from a biological sample using paramagnetic particles. b mRNA isolation using paramagnetic

microparticles with bound dT25. a–b The washing step, c adding a biological sample, d hybridization, e washing and f release of isolated mRNA [34]

particles were added. mRNA was captured on the surface of paramagnetic particles. In the following step, paramagnetic particles with captured mRNA were forced by magnet and rinsed. Finally, mRNA was released from the particles. The particles were again forced by magnet and mRNA containing solution was analysed [34]. We obtained tens of microlitres of the solution. Such small volumes could not be analysed by spectrometry to determine nucleic acids. Due to this fact, we suggested and utilized square wave voltammetry coupled with adsorptive transfer stripping technique for mRNA determination.

commercial paramagnetic particles DBT (Dynal) and MAGNa. Poly(A) as model of mRNA was used. To prepared paramagnetic particles, poly(A) (1, 5, 10, 20 and 30 μg.mL−1) was added. Further, poly(A) was hybridized on the surface of the particles for 10 min at 25 °C. Captured nucleic acid was released from the paramagnetic particles surface by heat treatment and shaking (85 °C, 1450 rpm, 10 min.). The other experimental details of semi-automated isolation of nucleic acids are introduced in Ref. No. [34]. Obtained solution was analysed electrochemically. MAGNa microparticles are of less specific working surface, which is used for isolation of DNA or, RNA. The main purpose of MAGNa particles utilization is to capture still constant amount of RNA and its application to PCR. The increased electrochemical signal with the increasing concentration of poly(A) isolated by two types of paramagnetic particles is shown in Fig. 2. The results

The effect of type of paramagnetic particles on mRNA isolation For mRNA isolation from biological sample in connection with electrochemical quantification, we utilized two

152

Microfluidic robotic device coupled with electrochemical sensor 120

100

Peak height (%)

80

using DBT particles and epMotion instrument was applied to quantitative mRNA isolation from plant samples. Increased concentration of cadmium(II) ions results in growth depression and structural changes in cluster structure at the end of 14 days long experiment. We determined that total mRNA level gradually enhanced with increasing cadmium(II) ions concentration. The highest concentration was determined in ESEs treated with 250 μM of cadmium(II) ions (Fig. 3a). Clusters cultivated on media contained higher cadmium(II) ions

Dynabeads y = 25.25x - 33.083 R² = 0.9645

Magna

193

y = 21.667x - 26.483 R² = 0.976

60

0 5

10

20

30

Given concentration of polyA (µM)

Fig. 2 Changes in cytosine-adenine peak height of poly(A) captured by MAGNa and DBT paramagnetic particles

mRNA detection in ESEs Early somatic embryos (ESEs) are suitable experimental model for monitoring of effect of heavy metals on plants. As it follows from the previously published results, ESEs exhibit considerable resistance to increased concentrations of heavy metals [14, 15, 42–49]. The exact mechanism of such higher resistance remains unclear. Photos of ESEs are shown in Fig. S-1A (ESM). ESE is consisted of (1) compact embryonic group, embryonic tubes, and suspensor cells. ESEs form clusters on the solid medium (bottom inset in Fig. S-1A). Automated procedure of mRNA isolation

B Electrochemical mRNA signal (µA.g-1)

demonstrate good affinity of poly(A) to both types of paramagnetic particles. However, DBT has higher yield of captured adenine chains (slope 25.25-DBT in comparison with 21.66-MAGNa). In the consequent experiments, we carried out fully automated isolation of poly(A) by using a robotic device epMotion. The working sequence was as follows: i) paramagnetic microparticles (10 μL) are pipetted into the PCR plate; ii) a washing cycle is three times repeated (50 μL); iii) the sample (poly(A), 10 μL) and hybridization solution (30 μL) are pipetted into PCR plates with paramagnetic microparticles; iv) 15 min. long hybridization at 25 °C is carried out; v) a washing cycle is three times repeated (50 μL). The PCR plate is later moved on thermostated position, where the denaturation of bound nucleic acid chain takes place. We tested the yield of DBT and MAGNa paramagnetic particles. Higher yield gave DBT paramagnetic particles.

100 nA

0

250

50 100 250 500 Concentration of cadmium(II) (µM) Control (0 µM BSO) C Control (0 µM cadmium(II))

200 150

100 50 0

600

400

200

0

0 50 100 250 500

0 20 40 60 80 100 Cadmium(II) concentration (µM) BSO concentration (µM)

D

Electrochemical mRNA signal (µA.g-1)

1

Electrochemical mRNA signal (µA.g-1)

A

20

Electrochemical mRNA signal

40

700 0

600

50

100

250

500 µM cadmium(II)

500 400

300 200 100 0 0

20

40

60

80

100

BSO concentration (µM)

Fig. 3 a Electrochemical signal of mRNA in ESEs treated with 0, 50, 100, 250 and 500 μM cadmium(II) ions in 14th experimental day. Volume of isolated sample was 10 μL. Electrochemical signals of mRNA isolated from ESEs treated with b cadmium(II) ions or with c buthionine sulphoximine (BSO). d Electrochemical signals of mRNA isolated from ESEs treated with cadmium(II) ions with or without addition of BSO. All results were obtained at the end of fourteen days long experiment

153

mRNA detection in maize plants Maize plants were exposed to cadmium(II) ions in concentrations 0, 5, 10, 25, 50 and 100 μM for 5 days. As it is obvious from the growth dependences, increasing concentration of the cadmium(II) ions as well as time of exposition leads to enhanced plant growth inhibition. A typical growth curve is shown in Fig. 4a. Changes in growth depending on the concentration of cadmium(II) ions in the fifth day of the experiment are well evident in Fig. 4b. The highest concentration of cadmium(II) ions (100 μM) resulted in significant growth inhibition from the third day of the exposition. These plants had one or two small leaves at the end of the experiment compared to control plants with four or five large leaves without morphological changes. Moreover, we determined changes in the content of chlorophyll in leaves of treated plants with increasing concentration of cadmium(II) ions at fifth day of the exposition (Fig. 4c). Content of chlorophyll did not change in plants treated with 5, 10 and 25 μM of cadmium (II) ions compared to control plants. Two highest applied concentration of cadmium(II) ions enhanced chlorophyll content. Besides this, we were interested whether content

A

Control (0 µM) 5 µM 10 µM 25 µM 50 µM

100

80

100 µM

60

40 0

2

4

6

Time of exposition (day)

B Concentration of cadmium(II) ions (µM) 5 10 0 25 50 100

C

Fluorescence of chlorophyll (%)

concentrations demonstrated lower mRNA level. The decline of mRNA level in these clusters is probably associated with inhibition of metabolic activity due to presence of heavy metal ions [15, 44, 47]. The results are shown in Fig. 3b. The electrochemical signal of the isolated mRNA gradually enhanced with increasing concentration of cadmium(II) ions. The highest signal was detected in extract from ESEs treated with 250 μM. All measurements were carried out in triplicates with R.S.D. app. 10 %. Furthermore, we were interested in the question whether using of our suggested procedure will be efficient in monitoring of changes of mRNA level during treatment of ESEs with buthionine sulphoximine (BSO) as an inhibitor of biosynthesis of reduced glutathione. mRNA levels in ESEs after 5 days long exposure to BSO are shown in Fig. 3c. BSO markedly enhanced the level of mRNA more than five times compared to control. Moreover, BSO stimulated synthesis mRNA more than three times intensively compared with cadmium(II) ions. If we simultaneously tested effect of both stress substances, BSO and cadmium(II) ions, we observed significant decrease of mRNA synthesis with increasing concentration of both compounds (Fig. 3d). BSO itself blocks pathways leading to the synthesis of glutathione and causes activation of alternative metabolic pathways to overcome the stress conditions due to BSO. In the event of negative influence of two stress factors (heavy metal ions and the inhibitor), plant metabolism is overburden and therefore mRNA transcription is decreased.

D. Huska et al.

Fresh weight of maize plants treated with cadmium(II) ions (%)

194

100

75

50

25

0 0

5

10

25

50

100

Concentration of cadmium(II) ions (µM) Fig. 4 a Fresh weight of in vitro cultivated treated and untreated maize plants. b Photos of maize plants on fifth day of cadmium(II) ions exposition. c Changes in chlorophyll content. Signal of 100% height corresponds to 872 mAU

of primary and secondary metabolites is changed due to presence of cadmium(II) ions. The changes in the roots were determined histochemically using K 3[Fe(CN)6], which is reduced in tissues with free-SH moieties on the blue colored reduction products [50] (arrows, Fig. S-1B, ESM). In control plants, free-SH moieties were detected in rhizodermis only. The enhanced biosynthesis of compounds containing free-SH groups were observed in plants treated with 10 μM of cadmium(II) ions, namely in rhizodermis as well as cortex. In contrast, almost no

154

Microfluidic robotic device coupled with electrochemical sensor

compounds with free-SH moieties were detected in plants treated with two highest concentration of cadmium(II) ions. However, especially in cortex, which is formed by metabolically active cells, synthesis of red colored compounds marked as “X” in these root sections was observed. The substances are polyphenols (probably anthocyanidins) demonstrating high antioxidant capability (Fig. S-1B). The presence of these substances is closely associated with oxidation stress in plants due to cadmium(II) ions, which are able to generate free oxygen radicals; these radicals are scavenged by the mentioned polyphenols. Plants exposed to stress are forced to increase the synthesis of various biologically active molecules, such as compounds containing free-SH group (reduced glutathione, phytochelatins, metallothionein like proteins), as we determined and discussed above (Fig. S-1B). Numerous of such molecules are synthesized by chemical reactions, but the enzymes involved in these reactions are gene-regulated. For these reasons, it is possible to observe the increased expression of certain groups of genes that lead to the increase in levels of total mRNA (transcriptome) in plants. In all analyzed samples, mRNA was obtained using paramagnetic microparticles and detected electrochemically. The presence and quality of mRNA obtained was verified on gel electrophoresis on chip. Using SWV, we determined well-developed signals at −1.65 V (Fig. S-2A, ESM). As it clearly follows from the Fig. S-2A, CA signal corresponding to isolated mRNA changes with increasing time of exposition and concentration of cadmium(II) ions. The quantity of isolated mRNA ranged from 0.1 to 2.5 μg.g−1 (poly(A) was used as a standard). In the first 3 days of the experiment, there was the increase in mRNA content in the shoot and roots of plants treated with cadmium(II) ions compared to control ones. Then, the content of mRNA markedly decreased (Fig. S-2B, ESM). At the end of the experiment, only control plants synthesized mRNA. To better understanding the effect of cadmium(II) ions, we attempted to average mRNA content according to concentration of cadmium(II) ions (upper part of Fig. S-2C) or day of the exposition (bottom part of Fig. S-2C, ESM). The highest concentration of cadmium(II) ions resulted in the highest enhancing of mRNA synthesis in average. In spite of the such metabolic activity, plants exposed to highest cadmium(II) ions concentration necrotized and died at the end of the experiment, which is well evident in average content of mRNA per day of the exposition. Moreover, we attempted to mathematically treat these data (Tab. S-1, ESM). Level of mRNA measured in maize plants treated with certain concentration of cadmium(II) ions in individual experimental days was linearly regressed with the following value of mRNA level. Thus, the slope of such regression shows rate of increase or decrease in the mRNA level.

195

Field experiments Besides the above discussed experiments with plants cultivated under well-defined laboratory conditions, we performed field experiment. Thirty days old plants were placed into cultivation vessels with tap water and 10 μM cadmium(II) ions only. Each four plants were harvested at strictly defined time intervals (7, 12, 17, and 21 days) during the experiment. DBT particles were used for mRNA isolation from tissues (leaves and roots) of treated as well as untreated maize plants. The content of mRNA was enhanced with increasing time of the treatment and varied from sub-units to units of μg. At the end of the treatment (21st day), maize plants were exhausted and mRNA content significantly reduced. Exhaustion of the plants was also demonstrated by decrease of chlorophyll content, as well as morphological changes involved in reduction of aerial plant parts as well as root system.

Conclusion Environmental analytical chemistry covers development of new analytical methods or improvement of existing ones useful for the monitoring of pollutants or trace amounts of naturally occurring active chemicals in the environment. Nanotechnology brings new possibilities in this scientific branch. In the introduced study, we use paramagnetic particles for isolation of mRNA as a marker of heavy metal stress. Our work demonstrates the possibility of mRNA isolation from plant cells, tissues, and organs by using of paramagnetic particles and correlation between concentration of cadmium(II) ions, time of exposition and mRNA levels. Acknowledgement The financial support from the grant NANOSEMED KAN208130801, INCHEMBIOL MSM0021622412 and REMEDTECH GACR 522/07/0692 is highly acknowledged. The authors wish to express their thanks to Jiri Baloun for excellent technical assistance.

References 1. Macek T, Kotrba P, Svatos A, Novakova M, Demnerova K, Mackova M (2008) Novel roles for genetically modified plants in environmental protection. Trends Biotechnol 26:146 2. Zehnalek J, Vacek J, Kizek R (2004) Application of higher plants in phytoremetiation of heavy metals. Listy Cukrov Reparske 120:220 3. Zehnalek J, Adam V, Kizek R (2004) Influence of heavy metals on production of protecting compounds in agriculture plants. Listy Cukrov Reparske 120:222 4. Greger M, Ogren E (1991) Direct and indirect effects of Cd2+ on photosynthesis in sugar beet (Beta vulgaris). Physiol Plant 83:129

155

196 5. Meister A, Anderson ME (1983) Glutathione. Annu Rev Biochem 52:711 6. Babula P, Ryant P, Adam V, Zehnalek J, Havel L, Kizek R (2009) The role of sulphur in cadmium(II) ions detoxification demonstrated in in vitro model: Dionaea muscipula Ell. Environ Chem Lett 7:353 7. Grill E, Winnacker EL, Zenk MH (1985) Phytochelatins—the principal heavy-metal complexing peptides of higher-plants. Science 230:674 8. Cobbett CS (2000) Phytochelatins and their roles in heavy metal detoxification. Plant Physiol 123:825 9. Supalkova V, Beklova M, Baloun J, Singer C, Sures B, Adam V, Huska D, Pikula J, Rauscherova L, Havel L, Zehnalek J, Kizek R (2008) Affecting of aquatic vascular plant Lemna minor by cisplatin revealed by voltammetry. Bioelectrochemistry 72:59 10. Zitka O, Stejskal K, Kleckerova A, Adam V, Beklova M, Horna A, Supalkova V, Havel L, Kizek R (2007) Utilizing electrochemical techniques for detection of biological samples. Chem Listy 101:225 11. Diopan V, Shestivska V, Adam V, Macek T, Mackova M, Havel L, Kizek R (2008) Determination of content of metallothionein and low molecular mass stress peptides in transgenic tobacco plants. Plant Cell Tiss Org 94:291 12. Zimeri AM, Dhankher OP, McCaig B, Meagher RB (2005) The plant MT1 metallothioneins are stabilized by binding cadmiums and are required for cadmium tolerance and accumulation. Plant Mol Biol 58:839 13. Diopan V, Baloun J, Adam V, Macek T, Havel L, Kizek R (2007) Determination of expression of metallothionein at transgenic tobacco plants. Listy Cukrov Reparske 122:325 14. Supalkova V, Huska D, Diopan V, Hanustiak P, Zitka O, Stejskal K, Baloun J, Pikula J, Havel L, Zehnalek J, Adam V, Trnkova L, Beklova M, Kizek R (2007) Electroanalysis of plant thiols. Sensors 7:932 15. Supalkova V, Petrek J, Baloun J, Adam V, Bartusek K, Trnkova L, Beklova M, Diopan V, Havel L, Kizek R (2007) Multiinstrumental investigation of affecting of early somatic embryos of spruce by cadmium(II) and lead(II) ions. Sensors 7:743 16. Babula P, Adam V, Opatrilova R, Zehnalek J, Havel L, Kizek R (2008) Uncommon heavy metals, metalloids and their plant toxicity: a review. Environ Chem Lett 6:189 17. Petrek J, Havel L, Petrlova J, Adam V, Potesil D, Babula P, Kizek R (2007) Analysis of salicylic acid in willow barks and branches by an electrochemical method. Russ J Plant Physiol 54:553 18. Supalkova V, Petrek J, Havel L, Krizkova S, Petrlova J, Adam V, Potesil D, Babula P, Beklova M, Horna A, Kizek R (2006) Electrochemical sensors for detection of acetylsalicylic acid. Sensors 6:1483 19. Mazarei M, Teplova I, Hajimorad MR, Stewart CN (2008) Pathogen phytosensing: plants to report plant pathogens. Sensors 8:2628 20. HammondKosack KE, Jones JDG (1996) Resistance genedependent plant defense responses. Plant Cell 8:1773 21. Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gutrella M, Kessmann H, Ward E, Ryals J (1994) A central role of salicylic-acid in plant-disease resistance. Science 266:1247 22. Diopan V, Babula P, Shestivska V, Adam V, Zemlicka M, Dvorska M, Hubalek J, Trnkova L, Havel L, Kizek R (2008) Electrochemical and spectrometric study of antioxidant activity of pomiferin, isopomiferin, osajin and catalposide. J Pharm Biomed Anal 48:127 23. Huska D, Baloun J, Krystofova O, Adam V, Zehnalek J, Beklova M, Havel L, Kizek R (2009) Profiling of stress transcriptome of selected genes in plants treated with heavy metals. Toxicol Lett 189:S161

D. Huska et al. 24. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA-polymerase. Science 239:487 25. Huska D, Adam V, Trnkova L, Kizek R (2009) The dependence of adenine isolation efficiency on the chain length evidenced using paramagnetic particles and voltammetry measurements. J Magn Magn Mater 321:1474 26. Drbohlavova J, Adam V, Kizek R, Hubalek J (2009) Quantum dots—characterization, preparation and usage in biological systems. Int J Mol Sci 10:656 27. Drbohlavova J, Hrdy R, Adam V, Kizek R, Schneeweiss O, Hubalek J (2009) Preparation and properties of various magnetic nanoparticles. Sensors 9:2352 28. Palecek E, Billova S, Havran L, Kizek R, Miculkova A, Jelen F (2002) DNA hybridization at microbeads with cathodic stripping voltammetric detection. Talanta 56:919 29. Masarik M, Cahova K, Kizek R, Palecek E, Fojta M (2007) Label-free voltammetric detection of single-nucleotide mismatches recognized by the protein MutS. Anal Bioanal Chem 388:259 30. Palecek E, Masarik M, Kizek R, Kuhlmeier D, Hassmann J, Schulein J (2004) Sensitive electrochemical determination of unlabeled MutS protein and detection of point mutations in DNA. Anal Chem 76:5930 31. Palecek E, Jelen F (2002) Electrochemistry of nucleic acids and development of DNA sensors. Crit Rev Anal Chem 32:261 32. Fojta M, Havran L, Vojtiskova M, Palecek E (2004) Electrochemical detection of DNA triplet repeat expansion. J Am Chem Soc 126:6532 33. Palecek E, Fojta M (2007) Magnetic beads as versatile tools for electrochemical DNA and protein biosensing. Talanta 74:276 34. Huska D, Hubalek J, Adam V, Vajtr D, Horna A, Trnkova L, Havel L, Kizek R (2009) Automated nucleic acids isolation using paramagnetic microparticles coupled with electrochemical detection. Talanta 79:402 35. Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473 36. Durzan DJ, Jokinen K, Guerra MP, Santerre A, Chalupa V, Havel L (1994) Latent diploid parthenogenesis and parthenote cleavage in egg-equivalents of Norway spruce. Int J Plant Sci 155:677 37. Vonarnold S (1987) Improved efficiency of somatic embryogenesis in mature embryos of Picea-abies (L) Karst. J Plant Physiol 128:233 38. Havel L, Durzan DJ (1996) Apoptosis during diploid parthenogenesis and early somatic embryogenesis of Norway spruce. Int J Plant Sci 157:8 39. Havel L, Durzan DJ (1996) Apoptosis in plants. Bot Acta 109:268 40. Vacek J, Petrek J, Kizek R, Havel L, Klejdus B, Trnkova L, Jelen F (2004) Electrochemical determination of lead and glutathione in a plant cell culture. Bioelectrochemistry 63:347 41. Petrlova J, Mikelova R, Stejskal K, Kleckerova A, Zitka O, Petrek J, Havel L, Zehnalek J, Adam V, Trnkova L, Kizek R (2006) Simultaneous determination of eight biologically active thiol compounds using gradient elution-liquid chromatography with Coul-Array detection. J Sep Sci 29:1166 42. Vitecek J, Adam V, Petrek J, Vacek J, Kizek R, Havel L (2003) Esterases as a marker for growth of BY-2 tobacco cells and early somatic embryos of the Norway spruce. Plant Cell Tissue Organ Cult 79:195 43. Adam V, Baloun J, Huska D, Krystofova O, Beklova M, Zehnalek J, Havel L, Kizek R (2008) Investigation of effects of glutathione synthesis inhibition on early somatic embryos treated with cadmium(II) ions. Toxicol Lett 180:S76

156

Microfluidic robotic device coupled with electrochemical sensor 44. Petrek J, Vitecek J, Vlasinova H, Kizek R, Kramer KJ, Adam V, Klejdus B, Havel L (2005) Application of computer imaging, stripping voltammetry and mass spectrometry to study the effect of lead (PbEDTA) on the growth and viability of early somatic embryos of Norway spruce (Picea abies/L./Karst.). Anal Bioanal Chem 383:576 45. Mikelova R, Baloun J, Petrlova J, Adam V, Havel L, Petrek H, Horna A, Kizek R (2007) Electrochemical determination of Ag-ions in environment waters and their action on plant embryos. Bioelectrochemistry 70:508 46. Vitecek J, Petrlova J, Petrek J, Adam V, Havel L, Kramer KJ, Kizek R (2007) Application of fluorimetric analysis of plant esterases to study of programmed cell death and effects of cadmium(II) ions. Biol Plant 51:551

197 47. Petrek J, Baloun J, Vlasinova H, Havel L, Adam V, Vitecek J, Babula P, Kizek R (2007) Image analysis and activity of intracellular esterases as new analytical tools for determination of growth and viability of embryonic cultures of spruce (Picea sp.) treated with cadmium. Chem Listy 101:569 48. Vitecek J, Adam V, Petrek J, Babula P, Novotna P, Kizek R, Havel L (2005) Application of fluorimetric determination of esterases in plant material. Chem Listy 99:496 49. Vitecek J, Petrlova J, Adam V, Havel L, Kramer KJ, Babula P, Kizek R (2007) A fluorimetric sensor for detection of one living cell. Sensors 7:222 50. Sippel TO (1978) Histochemistry of thiols and disulfides.2. Methodology of differential staining. Histochem J 10:585

157

5.5.2 Elektrochemická analýza rostlinné mRNA izolované pomocí paramagnetických mikro-částic v automatickém systému. V naší práci ukazujeme moţnost vyuţití paramagnetických částic ve spojení s elektrochemickými metodami pro analýzu mRNA jako markeru stresu způsobených těţkými kovy. Budoucí práce se budou zaměřovat na sledování konkrétních molekul mRNA související s těţkými kovy. Na základě jiţ vytvořených technik a postupů lze vytvořit metodu pro senzitivní a selektivní stanovení mRNA z malého mnoţství materiálu. Hlavním cílem této práce je kvantifikace transkriptomu u raných somatických embryí smrku ztepilého (Picea abies /L./ Karst.) a u rostlin kukuřice seté (Zea mays L.) ovlivněných ionty kadmia. Dále nás zajímalo, jaká se bude hladina transkriptomu

u

jednotlivých

vzorků

rostlin

měnit

působením

buthioninem

sulfoximinem (BSO) inhibitorem gama-glutamylcystein syntetázy, která syntetizuje glutation. Zajímala nás také interakce mezi BSO, kademnatými ionty a hladinou transkriptomu. Pro analýzu těchto interakcí, jak izolaci celkové mRNA, tak i její následnou detekci jsme pouţili námi navrhnutý a odzkoušený plně automatický systém sloţený z paramagnetických částic, pipetovací stanice a detekčního povrchu sloţeného z 96 elektrod natištěných na jednotnou destičku. S rostoucí koncentrací Cd2+ docházelo RSE k postupným morfologickým změnám a inhibici růstu. Hladina transkriptomu se zvyšovala s rostoucí koncentrací kademnatých iontů, přičemţ nejvyšší mnoţství bylo detekováno při koncentraci 250 µM

Cd2+ iontů. Hladina transkriptomu u vyšších

koncentracích Cd2+ iontů byla niţší, coţ pravděpodobně způsobil nadměrné působení Cd2+ iontů inhibující metabolickou aktivitu a značně narušující homeostázu. Ve srovnání s kontrolními rostlinami byl vliv BSO na celkové mnoţství mRNA aţ 5 násobný a 3 trojnásobný oproti vzorkům ovlivněných pouze kademnatými ionty. Naproti tomu při působení obou látek dohromady, hladina transkriptomu výrazně klesala s koncentrací

Cd2+ iontů i BSO. Zvýšení celkového mnoţství mRNA při

působení samotného BSO lze vysvětlit tím, ţe nedocházelo k syntéze glutationu, čím se aktivovaly alternativní metabolické dráhy, které by buňky chránily. Pokud však došlo k působení obou stresových činitelů současně, buňky uţ nebyly schopny tuto zátěţ unést a postupně odumíraly, čímţ lze vysvětlit postupné sníţení mnoţství transkriptomu. Vliv kademnatých iontů jsme sledovali i u rostlin Kukuřice seté, která byla vystavena po dobu 5 dnů 0, 5, 10, 25, 50 a 100 µM. Kademnaté ionty měly inhibiční vliv na růst

158

rostliny. Mnoţství chlorofylu v listech se u koncentrací 5, 10 a 25 µM neměnil ve srovnání s kontrolními rostlinami. Nicméně při vyšších dávkách kademnatých iontů došlo k nárůstu mnoţství chlorofylu. Na základě těchto výsledků nás dále zajímalo, jestli se obsah primárních a sekundárních metabolitů mění díky přítomnosti kademnatých iontů či nikoliv. Povedli jsme histochemickou analýzu pomocí K3[Fe(CN)6], který redukuje volné SH skupiny v pletivech na modře zbarvený produkt. Volné –SH skupiny jsme stanovovali u kořenů. Zvýšenou biosyntézu látek obsahující – SH skupiny jsme pozorovali u koncentrace 10 µM a však u dvakrát vyšších koncentrací Cd2+ iontů nebyly pozorovány téměř ţádné volné –SH skupiny. V kortexu kořene tvořeného z metabolicky aktivních buněk byly pozorovány červeně zabarvené místa. Toto zbarvení patří látkám s vysokou antioxidační kapacitou, jako jsou polyfenolické látky. Přítomnost těchto látek lze vysvětlit jako reakci na přítomnost kademnatých iontů v buňce generující volné kyslíkové radikály. Mnoţství celkové mRNA v prvních třech dnech se zvyšovalo jak v nadzemní části, tak i v kořenech v porovnání s kontrolními rostlinami. Po té mnoţství celkové mRNA výrazně kleslo, přičemţ syntéza mRNA pokračovala pouze u kontrolních rostlin. Přestoţe většina antioxidačních látek vzniká chemickou reakcí, enzymy katalyzující tyto reakce, jsou regulovány na úrovni genů, coţ vysvětluje nárůst celkového mnoţství mRNA v prvních dnech kultivace za přítomnosti kademnatých iontů. Pro studium polutantů v ţivotním prostředí, k pochopení jejich funkce a k jejich monitorování v posledních letech výrazným způsobem zasahují nanotechnologie, přinášející nové materiály a zařízení umoţňující vzniknout nebo vylepšit stávající metody.

159

5.6 Markery pro posouzení hyperakumulace, senzitivity a rezistence rostlin k těţkým kovům Vědecký článek v přípravě Metody pro studium nukleových kyselin a jejich identifikaci vyţadují velmi senzitivní analytické nástroje (Hadidi, a kol., 2004, Park, a kol., 2002). Rozhodující sloţkou analýzy nukleových kyselin je metoda jejich detekce a izolace (Wang, 2003). V současnosti se jiţ běţně vyuţívají paramagnetické částice (MPs) pro izolaci nukleových kyselin (NA) (Haun, a kol., 2010, Huska, a kol., 2009, Kim, a kol., 2003, Shen, a kol., 2012, Waschke, a kol., 2006). Lze je vyuţít jak pro RNA tak i DNA. Do technik vyuţívající paramagnetické částice výrazným způsobem zasáhly nanočástice (NPs), které jejich moţnosti vyuţití v izolaci a detekci značně rozšířily a to zejména v identifikaci specifických sekvencí, genů (Haun, a kol., 2010, Wang, 2000, Wang, 2003). Nanočástice díky své velikosti řádově 1 - 100 nm mají velký interakční povrch, vysokou mechanickou odolnost, vynikající elektrické, katalytické a magnetické vlastnosti a moţnosti interagovat s širokou škálou biologických a chemických látek (Berry a Curtis, 2003, Chomoucka, a kol., 2010, Sarikaya, a kol., 2003) Samotná izolace NK pro jejich studium nestačí. Izolované NK se musí vhodnou metodou detekovat, jak kvalitativně tak kvantitativně. Pro tyto účely se velmi dobře hodí elektrochemické metody a to zejména díky jejich citlivosti, ekonomičnosti a v moţnosti je propojovat a automatizovat s jinými metodami (Hadidi, a kol., 2004, Huska, a kol., 2010, Huska, a kol., 2009, Vacek, a kol., 2011, Wang, a kol., 2003). V této práci jsme sestrojili hybridizační kit pro izolaci a detekci různých specifických nukleových kyselin z jedné matrice. Metoda byla aplikována na tři námi vybrané různé sekvence mRNA. Konkrétně se jednalo o mRNA kódující protein vázající kov a zastupovala marker hyperakumulace: CAGTGGATGTGTGCAGTACAT ATTG. Dále to byla mRNA kódující ATPázu umoţňující transport Cd iontů přes membránu

tj.

marker

senzitivity

kukuřice

k

Cd

iontům:

CTCCCTCAAGCTACACCGCAAA; A poslední marker rezistence rostlin k těţkým kovům byl zastoupen mRNA kódující enzym gama-glutamylcystein syntetázu:

160

GGGTTGGGCTGCTGTACGACGAGGAAT. Zajímalo nás, jestli jsme navrhnutou technikou schopni identifikovat a kvantifikovat jednotlivé mRNA z biologické matrice. Postup je zaloţen na detekci kovových nanočástic ZnNPs, PbNPs a CdNPs. Kovy lze pomocí elektrochemických technik velice senzitivně a selektivně stanovit. Nanočástice z různých kovů pak poskytují signály při odlišných potenciálech -1.03 ± 0.005 V (Zn), -0.63 ± 0.005 V (Cd) a

-0.45 ± 0.005 V (Pb) Postup znázorňuje

Obrázek 15. Nejdříve proběhne pomocí paramagnetických částic (Obrázek 15A) izolace cílových sekvencí (mRNA) ze vzorku. Po hybridizaci cílových sekvencí k MPs následuje krok promytí, pro odstranění interferujících látek (nenavázané NK, proteiny, zbytky matrice, nekomplementárních NK). Nyní bychom mohli navázané různé cílové sekvence eluovat do roztoku a detekovat. Nicméně bychom pouze získali informaci o celkovém mnoţství izolovaných mRNA nikoli o jejich sekvenci. Pro rozlišení jednotlivých specifických sekvencí a zároveň jejich kvantifikaci, jsme k MPs s cílovými mRNA přidali nanočástice syntetizovaných ze zinku, kadmia a olova (ZnNPs, CdNPs, PbNPs) na Obrázku 15B označeny jako XNPs. NPs mají přes – SH skupinu na sobě navázanou oligonukleotidovou sondu (anti sense řetězec), která se váţe na cílovou sekvenci vyizolovanou paramagnetickými částicemi. Komplex XNPs se sondou jsme označili jako (ODN-SH-ZnNPs; ODN-SH-CdNPs; ODN-SH-PbNPs). Jakmile se sondy naváţí na cílové sekvence, můţe proběhnout jejich stanovení pomocí elektrochemie (Obrázek 15C,D).

161

Obrázek

15:

Schéma

postupu

při

detekci

specifických

sekvencí

pomocí

paramagnetických mikro částic, nanočástic a elektrochemie. A) paramagnetická částice s oligonukletidovou sondou sloţenou z tyminů a přidání vzorku (cílová mRNA) k MPs B) Hybridizace cílové mRNA na MPs a přidání druhé sondy ODN-SH-NPs komplementární k cílové mRNA. C) Hybridizace ODN-SH-NPs na cílovou mRNA jiţ nahybridozovanou na MPs. D) Elektrochemická detekce XNPs respektive cílových sekvencí. Pomocí ODN-SH-XNPs můţeme kvantifikovat tři různé cílové mRNA současně. Při detekci získáváme dva signály na základě pouţití dvou různých elektrochemických metod. Signál odpovídající ODN-SH (SWV) a signál odpovídající samotnému kovu (DPV). V případě detekce obou signálů dostáváme informaci o tom, ţe daná cílová sekvence se na MPs nachází. V případě detekce pouze signálu pro ODN-SH nebo kov, můţeme usuzovat, ţe nedošlo k navázání sondy na cílovou sekvenci správně a nelze

162

daný signál vyhodnocovat. Všechny uvedené kroky se nám podařilo navíc plně zautomatizovat pomocí automatické pipetovací stanice uzpůsobené pro práci s částicemi. Pro správnou funkčnost hybridizačního kitu, bylo zapotřebí jednotlivé kroky optimalizovat. Izolace cílových sekvencí pomocí paramagnetických částic probíhala podle (Húska a kol, 2009), proto se hlavní část práce soustředila na optimalizaci detekce ODN-SH-XNPs.

Vliv akumulace ODN-SH-XNPs a samotné

ODN-SH na pracovní elektrodu ukazuje Obrázek 16. Měřen byl jak signál z potenciálové oblasti kolem -1.4V, který patří oligonukleotidům respektive bázím adeninu a cytozinu (CA peak), tak i signály pro jednotlivé nanočástice tvořené z Zn, Cd a Pb a to v potenciálových oblastech -1.03V (Zn), −0.63V (Cd) a

−0.45V (Pb).

Nejlepší odezvu signálu CA peak, získáváme při detekci samotné ODN-SH, které nemají na sobě navázány NPs a to při době akumulace 120 – 180s Obrázek 16A. Signály všech ODN-SH-NPs jsou při stejné době akumulace o 50% niţší neţ ODN-SH Obrázek 16A. Nicméně poskytují dostatečný signál, pro jejich stanovení. Dále byly vyhodnoceny signály poskytnuté od jednotlivých kovů (Zn peak-červeně); (Pb peakzeleně) a (Cd peak-fialově) (Obrázek 16 B, C, D). U všech sledovaných sond s rostoucí dobou akumulace na pracovní elektrodu roste i odezva signálu respektive mnoţství navázaných molekul. Oproti signálu ODN-SH bylo pro dosaţení maxima zapotřebí delší doby akumulace (Obrázek 16A). Nejdéle pro plné nasycení pracovní elektrody potřebovaly sondy ODN-SH-Zn a ODN-SH-Pb, kdy největší signál byl při době akumulace 900 a 1000 s (Obrázek 16B,C). Maximální pík u ODN-SH-Cd lze pozorovat jiţ při 390 s (Obrázek 16B). A

B

C

D

163

Obrázek 16: Optimalizace doby akumulace (s): A) CA signál ODN-SH (♦); ODN-SHZnNPs (♦); ODN-SH-PbNPs (♦); a ODN-SH-CdNPs (♦); B) Zn signál ODN-SH-ZnNPs (♦); C) Pb signál ODN-SH-PbNPs (♦); D) Cd signál ODN-SH-CdNPs (♦); koncentrace ODN-SH a ODN-SH-NPs byla 2µg/ml.

Dále nás zajímalo, jestli jsme schopni na XNPs navázat různé mnoţství ODN a toto mnoţství detekovat. Vliv koncentrace ODN na výšku CA píku ukazuje Obrázek 17. Koncentrace ODN, která se vázala přes SH skupinu na NPs byla v rozmezí 0.002 – 2 µg/ml. U všech studovaných sond s rostoucí koncentrací roste i výška píku s polynomickým průběhem. Nicméně u všech vidíme i lineární úsek, který se pohybuje u všech sond v rozmezí hodnot 0.002 – 0.125 µg/ml. Rovnice regrese pro jednotlivé sondy s faktory spolehlivosti R2=0.99 ukazuje Obrázek 17. Pokud porovnáme ODNSH s ODN-SH-NPs vidíme, ţe NPs ovlivňují odezvu CA píku. Největší vliv na odezvu signálu mají PbNPs. Naopak nejmenší vliv na signál ODN měli CdNPs. Nicméně u

všech NPs lze detekovat nejniţší studovanou koncentraci 2 ng/ml. Obrázek 17: Závislost koncentrace ODN na odezvě CA signálu pro ODN-SH (♦); ODN-SH-ZnNPs(♦); ODN-SH-PbNPs(♦) a ODN-SH-CdNPs (♦).

164

Optimalizace teploty hybridizace Pro zajištění co nejlepší vazby ODN-SH-NPs na cílovou NK navázanou na MPs bylo nutné zjistit, jak tuto vazbu ovlivňuje teplota Obrázek 18. Cílové NK jsme nechali interagovat 30 min s 2,5; 5; 10; 15 a 20 µg/ml ODN-SH-NPs při teplotách 15°C, 20°C, 25°C a 30°C a následně jsme měřili odezvu signálu CA píku ( Obrázek 18A, C, E) a odezvu signálu Cd, Zn a Pb píku ( Obrázek 18 B, D, F). Jak je patrné z obrázku 18 nejvíce ODN-SH-NPs bylo detekováno při teplotě hybridizace 25°C a to u všech pouţitých koncentrací. Nejméně

sond se na cílovou NK navázalo při teplotě 30°C. Výjimkou byla sonda ODN-SHCdNPs, u které se při koncentraci sondy 10 a 20 µg/ml navázalo více sond neţ u teplot hybridizace 20°C a 15°C.

165

Obrázek 18: Závislost signálu (%) na koncentraci ODN-SH-NPs (µg/ml), (na levé straně – CA signál; na pravé straně – signál jednotlivých kovových NPs v komplexu ODN-SH-xNPs) Pro posouzení jestli signál CA píku a píku pro NPs spolu souvisí, jsme provedli korelační analýzu Obrázek 19. Vynesli jsme procentuální hodnoty signálů pro jednotlivé NPs, teplot a koncentrací.

U PbNPs spolu signály korelovaly na 77%

Obrázek 19A. ZnNPs korelovaly na 89% (Obrázek 19B) a CdNPs na 91% (Obrázek 19C). Dále jsme provedli Spearman Rank-Order Correlation analysis. Zde byl korelační koeficient u PbNPs 0,90 pro ZnNPs 0,89 a korelační koeficient pro CdNPs byl 0,96.

Obrázek 19: Korelace mezi signálem CA poskytnutým od ODN a signálem pocházejícím od XNPs. Signály pro 30°C, 25°C, 20°C a 15°C jsou znázorněny červeně, zeleně, tmavě modře a světle modře. Koncentrace ODN-SH-xNPs 2.5; 5; 10; 15 a 20 µg/ml. Předchozími experimenty jsme stanovili přesné podmínky jednotlivých kroků celého postupu. Nyní jsme mohli postup aplikovat na připravených vzorcích obsahující námi vybrané cílové mRNA. Zkumavky se vzorky byly umístěny do automatické pipetovací stanice, kde

proběhla

jejich izolace za

pomocí MPs

a vlastní

navázání

komplementárních ODN sond k vyizolovaným mRNA: i) CAGTGGATGTGTGCAGTACAT -SH-ZnNPs, ii) CTCCCTCAAGCTACACCGCAAA-SH-CdNPs iii) GGGTTGGGCTGCTGTACGACGAGGAAT-SH-PbNPs

166

Po promytí byl výsledný produkt změřen pomocí DPV. Elektrochemické záznamy pro jednotlivé signály NPs ukazuje Obrázek 20A. Červená křivka znázorňuje záznam ZnNPs (respektive mRNA kódující protein vázající kov) přičemţ pík se nachází v potenciálové oblasti -1,03 ± 0,005V. Fialová křivka odpovídá záznamu CdNPs (respektive ATPáze přenášející Cd ionty) a píku Cd při potenciálu -0.63 ± 0,005V. Zelená křivka ukazuje PbNPs (respektive mRNA kódující enzym gama-glutamylcystein syntetázu) a pík Pb v potenciálové oblasti -0,45 ± 0,005V. Získané signály jsou dobře identifikovatelné a píky symetrické a dobře odečitatelné. Posledním experimentem bylo detekovat jednotlivé mRNA v jednom měření. Voltamogram z tohoto měření ukazuje Obrázek 20B. Na záznamu vidíme všechny tři píky v daných potenciálových oblastech odpovídající postupně z levé strany ZnNPs, CdNPs a PbNPs respektive jednotlivým mRNA. Podařilo se nám sestrojit zcela unikátní elektrochemický nanobiosenzor, který umoţňuje studovat expresy genů bez náročnějšího přístrojového vybavení. Pomocí tohoto nanobiosenzoru jsme byly schopni stanovit jednotlivé specifické mRNA odpovídající markérům hyperakumulace senzitivity a rezistence rostlin k iontům těţkých kovů.

Obrázek 20: A: voltamogramy Zn, Cd and Pb signálu z komplexu i) CAGTGGATGTGTGCAGTACAT -SH-ZnNPs(-) ii) GGGTTGGGCTGCTGTACGACGAGGAAT-SH-PbNPs (-) iii) CTCCCTCAAGCTACACCGCAAA-SH-CdNPs (-), měřených pomocí DPV. B: směs oligonukleotidů z části A.

167

6

Závěr Vývoj nových metod pro studium biologických procesů je stejně důležité jako

samotné studování biologických procesů. Práce ukazuje nové metody a postupy umožňující sledovat nukleové kyseliny a proteiny a jejich interakce s ionty těžkých kovů. Všechny metody a techniky jsou především založeny na využití vzájemného propojení

elektrochemických

technik,

paramagnetických

částic,

nanočástic

a

automatické pipetovací stanice. Propojením jednotlivých nástrojů tak získáváme elektrochemické bionanosenzory (EBiNS). Vysoká citlivost EBiNS a možnost jejich miniaturizace, kompatibilitu s moderními technologiemi, nízkou cenou, nízkými nároky na napájení (možnost využití in-situ) se tak stávají významnými kandidáty pro analýzu biomolekul, specifických nukleových kyselin a sledování exprese genů. Uvedené metody byly aplikovány na reálné vzorky raných somatických embryí smrku ztepilého (ESEs) a rostlin kukuřice seté. U těchto rostlin byl studován vliv iontů těžkých kovů na změnu hladin transkriptomu a tiolových látek. Významným výsledkem této práce byla analýza obsahu vody u ESEs pomocí nukleární magnetické rezonance, což u ESEs doposud nebylo provedeno. Dalším významným výsledkem bylo sestrojení zcela unikátního elektrochemického nanobiosenzoru, který umožňuje sledovat expresi genů. Nanobiosenzor je založen na dvojité hybridizaci a elektrochemické detekci. Díky nanočásticím z různých kovů, které při elektrochemické detekci poskytují signály v různých potenciálových oblastech, tak můžeme stanovit současně tři různé mRNA v jednom skenu a určit jejich expresi. Tato technika umožňuje identifikaci genů či stanovení genové exprese vybraných genů. Předkládaná práce poskytuje zcela nový pohled na využití elektrochemických technik, paramagnetických částic a nanočástic pro posouzení vhodnosti rostliny k fytoremediačním účelům a to díky sledování interakce mezi rostlinou, těžkým kovem, nukleovou kyselinou a proteiny.

168

7

POUŢITÁ LITERATURA

ABOU AUDA, M.; ALI, E. E. CADMIUM AND ZINC TOXICITY EFFECTS ON GROWTH AND MINERAL NUTRIENTS OF CARROT (DAUCUS CAROTA). Pakistan Journal of Botany, 2010, roč. 42. č. 1, s. 341-351. ISS 0556-3321. AGARWAL, P. K.; JHA, B. Transcription factors in plants and ABA dependent and independent abiotic stress signalling. Biologia Plantarum, 2010, roč. 54. č. 2, s. 201-212. ISS 0006-3134. AHSAN, N.; RENAUT, J.; KOMATSU, S. Recent developments in the application of proteomics to the analysis of plant responses to heavy metals. Proteomics, 2009, roč. 9. č. 10, s. 2602-2621. ISS 1615-9853. AHUJA, I.; DE VOS, R. C. H.; BONES, A. M.; HALL, R. D. Plant molecular stress responses face climate change. Trends in Plant Science, 2010, roč. 15. č. 12, s. 664-674. ISS 1360-1385. AINA, R.; LABRA, M.; FUMAGALLI, P.; VANNINI, C.; MARSONI, M.; CUCCHI, U.; BRACALE, M.; SGORBATI, S.; CITTERIO, S. Thiol-peptide level and proteomic changes in response to cadmium toxicity in Oryza sativa L. roots. Environmental and Experimental Botany, 2007, roč. 59. č. 3, s. 381-392. ISS 0098-8472. AKBARZADEH, A.; SAMIEI, M.; DAVARAN, S. Magnetic nanoparticles: preparation, physical properties, and applications in biomedicine. Nanoscale Research Letters, 2012, roč. 7. č., s. 1-13. ISS 1931-7573. ALBA, R.; FEI, Z. J.; PAYTON, P.; LIU, Y.; MOORE, S. L.; DEBBIE, P.; COHN, J.; D'ASCENZO, M.; GORDON, J. S.; ROSE, J. K. C.; MARTIN, G.; TANKSLEY, S. D.; BOUZAYEN, M.; JAHN, M. M.; GIOVANNONI, J. ESTs, cDNA microarrays, and gene expression profiling: tools for dissecting plant physiology and development. Plant Journal, 2004, roč. 39. č. 5, s. 697-714. ISS 0960-7412. AN, L. Y.; PAN, Y. H.; WANG, Z. B.; ZHU, C. Heavy metal absorption status of five plant species in monoculture and intercropping. Plant and Soil, 2011, roč. 345. č. 1-2, s. 237-245. ISS 0032-079X. ANDERSON, N. L.; ANDERSON, N. G. Proteome and proteomics: New technologies, new concepts, and new words. Electrophoresis, 1998, roč. 19. č. 11, s. 18531861. ISS 0173-0835. ANJUM, N. A.; AHMAD, I.; MOHMOOD, I.; PACHECO, M.; DUARTE, A. C.; PEREIRA, E.; UMAR, S.; AHMAD, A.; KHAN, N. A.; IQBAL, M.; PRASAD, M. N. V. Modulation of glutathione and its related enzymes in plants' responses to toxic metals and metalloids-A review. Environmental and Experimental Botany, 2012, roč. 75. č., s. 307-324. ISS 0098-8472.

169

APEL, K.; HIRT, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology, 2004, roč. 55. č., s. 373-399. ISS 1040-2519. APPENROTH, K. J. Definition of "Heavy Metals" and Their Role in Biological Systems. In: SHERAMETI, I.; VARMA A., eds. Soil Heavy Metals, 2010 (vol 19). APPENROTH, K. J. What are "heavy metals" in Plant Sciences? Acta Physiologiae Plantarum, 2010, roč. 32. č. 4, s. 615-619. ISS 0137-5881. ARIMURA, G.; KOST, C.; BOLAND, W. Herbivore-induced, indirect plant defences. Biochimica Et Biophysica Acta-Molecular and Cell Biology of Lipids, 2005, roč. 1734. č. 2, s. 91-111. ISS 1388-1981. ATKINSON, R. Atmospheric chemistry of VOCs and NOx. Atmospheric Environment, 2000, roč. 34. č. 12-14, s. 2063-2101. ISS 1352-2310. BABULA, P.; ADAM, V.; OPATRILOVA, R.; ZEHNALEK, J.; HAVEL, L.; KIZEK, R. Uncommon heavy metals, metalloids and their plant toxicity: a review. Environmental Chemistry Letters, 2008, roč. 6. č. 4, s. 189-213. ISS 1610-3653. BALDWIN, I. T.; HALITSCHKE, R.; PASCHOLD, A.; VON DAHL, C. C.; PRESTON, C. A. Volatile signaling in plant-plant interactions: "Talking trees" in the genomics era. Science, 2006, roč. 311. č. 5762, s. 812-815. ISS 00368075. BARD, A. J.; ZHOU, H. J.; KWON, S. J. Electrochemistry of Single Nanoparticles via Electrocatalytic Amplification. Israel Journal of Chemistry, 2010, roč. 50. č. 3, s. 267-276. ISS 0021-2148. BEN FREDJ, F.; IRIE, M.; HAN, J.; YAMADA, P.; LIMAM, A.; GHRABI, A.; MORIO, T.; ISODA, H. STRESS RESPONSE OF HEAVY METAL MIXTURE PRESENT IN WASTEWATER AND LEACHATE ON HEATSHOCK PROTEIN 47-TRANSFECTED CELLS. Environmental Toxicology and Chemistry, 2010, roč. 29. č. 7, s. 1637-1647. ISS 0730-7268. BERNARD, C.; ROOSENS, N.; CZERNIC, P.; LEBRUN, M.; VERBRUGGEN, N. A novel CPx-ATPase from the cadmium hyperaccumulator Thlaspi caerulescens. Febs Letters, 2004, roč. 569. č. 1-3, s. 140-148. ISS 0014-5793. BERROCAL-LOBO, M.; MOLINA, A.; SOLANO, R. Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant Journal, 2002, roč. 29. č. 1, s. 23-32. ISS 0960-7412. BERRY, C. C.; CURTIS, A. S. G. Functionalisation of magnetic nanoparticles for applications in biomedicine. Journal of Physics D-Applied Physics, 2003, roč. 36. č. 13, s. R198-R206. ISS 0022-3727.

170

BIES-ETHEVE, N.; GAUBIER-COMELLA, P.; DEBURES, A.; LASSERRE, E.; JOBET, E.; RAYNAL, M.; COOKE, R.; DELSENY, M. Inventory, evolution and expression profiling diversity of the LEA (late embryogenesis abundant) protein gene family in Arabidopsis thaliana. Plant Molecular Biology, 2008, roč. 67. č. 1-2, s. 107-124. ISS 0167-4412. BONEH, U.; BITON, I.; ZHENG, C. L.; SCHWARTZ, A.; BEN-ARI, G. Characterization of potential ABA receptors in Vitis vinifera. Plant Cell Reports, 2012, roč. 31. č. 2, s. 311-321. ISS 0721-7714. BRANDT, B.; BRODSKY, D. E.; XUE, S. W.; NEGI, J.; IBA, K.; KANGASJARVI, J.; GHASSEMIAN, M.; STEPHAN, A. B.; HU, H. H.; SCHROEDER, J. I. Reconstitution of abscisic acid activation of SLAC1 anion channel by CPK6 and OST1 kinases and branched ABI1 PP2C phosphatase action. Proceedings of the National Academy of Sciences of the United States of America, 2012, roč. 109. č. 26, s. 10593-10598. ISS 0027-8424. CAI, H.; XU, Y.; ZHU, N. N.; HE, P. G.; FANG, Y. Z. An electrochemical DNA hybridization detection assay based on a silver nanoparticle label. Analyst, 2002, roč. 127. č. 6, s. 803-808. ISS 0003-2654. CANOVAS, F. M.; DUMAS-GAUDOT, E.; RECORBET, G.; JORRIN, J.; MOCK, H. P.; ROSSIGNOL, M. Plant proteome analysis. Proteomics, 2004, roč. 4. č. 2, s. 285-298. ISS 1615-9853. CAO, Y. W. C.; JIN, R. C.; MIRKIN, C. A. Nanoparticles with Raman spectroscopic fingerprints for DNA and RNA detection. Science, 2002, roč. 297. č. 5586, s. 1536-1540. ISS 0036-8075. CAZALE, A. C.; CLEMENS, S. Arabidopsis thaliana expresses a second functional phytochelatin synthase. Febs Letters, 2001, roč. 507. č. 2, s. 215-219. ISS 00145793. CHAFFAI, R.; KOYAMA, H. Heavy Metal Tolerance in Arabidopsis thaliana. In: KADER, J. C.; DELSENY M., eds. Advances in Botanical Research, Vol 60, 2011 (vol 60). CHEN, W. Q.; PROVART, N. J.; GLAZEBROOK, J.; KATAGIRI, F.; CHANG, H. S.; EULGEM, T.; MAUCH, F.; LUAN, S.; ZOU, G. Z.; WHITHAM, S. A.; BUDWORTH, P. R.; TAO, Y.; XIE, Z. Y.; CHEN, X.; LAM, S.; KREPS, J. A.; HARPER, J. F.; SI-AMMOUR, A.; MAUCH-MANI, B.; HEINLEIN, M.; KOBAYASHI, K.; HOHN, T.; DANGL, J. L.; WANG, X.; ZHU, T. Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. Plant Cell, 2002, roč. 14. č. 3, s. 559-574. ISS 1040-4651. CHEN, W. Q.; SINGH, K. B. The auxin, hydrogen peroxide and salicylic acid induced expression of the Arabidopsis GST6 promoter is mediated in part by an ocs element. Plant Journal, 1999, roč. 19. č. 6, s. 667-677. ISS 0960-7412.

171

CHENG, S. P. Effects of heavy metals on plants and resistance mechanisms. Environmental Science and Pollution Research, 2003, roč. 10. č. 4, s. 256-264. ISS 0944-1344. CHIANG, H.-C.; LO, J.-C.; YEH, K.-C. Genes associated with heavy metal tolerance and accumulation in Zn/Cd hyperaccumulator Arabidopsis halleri: A genomic survey with cDNA microarray. Environmental Science & Technology, 2006, roč. 40. č. 21, s. 6792-6798. ISS 0013-936X. CHIOU, T. J.; AUNG, K.; LIN, S. I.; WU, C. C.; CHIANG, S. F.; SU, C. L. Regulation of phosphate homeostasis by microRNA in Arabidopsis. Plant Cell, 2006, roč. 18. č. 2, s. 412-421. ISS 1040-4651. CHOMOUCKA, J.; DRBOHLAVOVA, J.; HUSKA, D.; ADAM, V.; KIZEK, R.; HUBALEK, J. Magnetic nanoparticles and targeted drug delivering. Pharmacol. Res., 2010, roč. 62. č. 2, s. 144-149. ISS 1043-6618. clanek IF 3.929 CHUANG, H. W.; WANG, I. W.; LIN, S. Y.; CHANG, Y. L. Transcriptome analysis of cadmium response in Ganoderma lucidum. Fems Microbiology Letters, 2009, roč. 293. č. 2, s. 205-213. ISS 0378-1097. CLEMENS, S. Molecular mechanisms of plant metal tolerance and homeostasis. Planta, 2001, roč. 212. č. 4, s. 475-486. ISS 0032-0935. CLEMENS, S. Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants. Biochimie, 2006, roč. 88. č. 11, s. 1707-1719. ISS 03009084. COBBETT, C.; GOLDSBROUGH, P. Phytochelatins and metallothioneins: Roles in heavy metal detoxification and homeostasis. Annual Review of Plant Biology, 2002, roč. 53. č., s. 159-182. ISS 1040-2519. COBBETT, C. S. Phytochelatins and their roles in heavy metal detoxification. Plant Physiology, 2000, roč. 123. č. 3, s. 825-832. ISS 0032-0889. COELLO, P.; HIRANO, E.; HEY, S. J.; MUTTUCUMARU, N.; MARTINEZBARAJAS, E.; PARRY, M. A. J.; HALFORD, N. G. Evidence that abscisic acid promotes degradation of SNF1-related protein kinase (SnRK) 1 in wheat and activation of a putative calcium-dependent SnRK2. Journal of Experimental Botany, 2012, roč. 63. č. 2, s. 913-924. ISS 0022-0957. CRAMER, G. R.; URANO, K.; DELROT, S.; PEZZOTTI, M.; SHINOZAKI, K. Effects of abiotic stress on plants: a systems biology perspective. Bmc Plant Biology, 2011, roč. 11. č., s. ISS 1471-2229. CUNNINGHAM, S. D.; BERTI, W. R. Phytoextraction and phytostabilization: Technical, economic, and regulatory considerations of the soil-lead issue. In: TERRY, N.; BANUELOS G., eds. Phytoremediation of Contaminated Soil and Water. Boca Raton: Lewis Publishers Inc, 2000.

172

DAI, H. J. Carbon nanotubes: Synthesis, integration, and properties. Accounts of Chemical Research, 2002, roč. 35. č. 12, s. 1035-1044. ISS 0001-4842. DAI, H. P.; JIA, G. L.; FENG, S. J.; WEI, A. Z.; SONG, H.; YANG, T. X.; WANG, C. F. Phytoremediation with transgenic poplar. Journal of Food Agriculture & Environment, 2011, roč. 9. č. 3-4, s. 710-713. ISS 1459-0255. DALCORSO, G.; FARINATI, S.; MAISTRI, S.; FURINI, A. How plants cope with cadmium: Staking all on metabolism and gene expression. Journal of Integrative Plant Biology, 2008, roč. 50. č. 10, s. 1268-1280. ISS 1672-9072. DANIEL, M. C.; ASTRUC, D. Gold nanoparticles: Assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology. Chemical Reviews, 2004, roč. 104. č. 1, s. 293346. ISS 0009-2665. DAVIS, R. J. Signal transduction by the JNK group of MAP kinases. Cell, 2000, roč. 103. č. 2, s. 239-252. ISS 0092-8674. DE-LOS-SANTOS-ALVAREZ, P.; LOBO-CASTANON, M. J.; MIRANDAORDIERES, A. J.; TUNON-BLANCO, P. Electrochemistry of nucleic acids at solid electrodes and its applications. Electroanalysis, 2004, roč. 16. č. 15, s. 1193-1204. ISS 1040-0397. DESIKAN, R.; MACKERNESS, S. A. H.; HANCOCK, J. T.; NEILL, S. J. Regulation of the Arabidopsis transcriptome by oxidative stress. Plant Physiology, 2001, roč. 127. č. 1, s. 159-172. ISS 0032-0889. DESTRO, T.; PRASAD, D.; MARTIGNAGO, D.; BERNET, I. L.; TRENTIN, A. R.; RENU, I. K.; FERRETTI, M.; MASI, A. Compensatory expression and substrate inducibility of gamma-glutamyl transferase GGT2 isoform in Arabidopsis thaliana. Journal of Experimental Botany, 2011, roč. 62. č. 2, s. 805-814. ISS 0022-0957. DI TOPPI, L. S.; GABBRIELLI, R. Response to cadmium in higher plants. Environmental and Experimental Botany, 1999, roč. 41. č. 2, s. 105-130. ISS 0098-8472. DICULESCU, V. C.; PAQUIM, A. M. C.; BRETT, A. M. O. Electrochemical DNA sensors for detection of DNA damage. Sensors, 2005, roč. 5. č. 6-10, s. 377-393. ISS 1424-8220. DING, Y. F.; CHEN, Z.; ZHU, C. Microarray-based analysis of cadmium-responsive microRNAs in rice (Oryza sativa). Journal of Experimental Botany, 2011, roč. 62. č. 10, s. 3563-3573. ISS 0022-0957. DING, Y. F.; ZHU, C.; WANG, S. S.; LIU, H. L. Regulation of Heavy Metal Stress Response by Plant microRNAs. Progress in Biochemistry and Biophysics, 2011, roč. 38. č. 12, s. 1106-1110. ISS 1000-3282.

173

DIXON, D. P.; CUMMINS, I.; COLE, D. J.; EDWARDS, R. Glutathione-mediated detoxification systems in plants. Current Opinion in Plant Biology, 1998, roč. 1. č. 3, s. 258-266. ISS 1369-5266. DORIA, G.; CONDE, J.; VEIGAS, B.; GIESTAS, L.; ALMEIDA, C.; ASSUNCAO, M.; ROSA, J.; BAPTISTA, P. V. Noble Metal Nanoparticles for Biosensing Applications. Sensors, 2012, roč. 12. č. 2, s. 1657-1687. ISS 1424-8220. DRAGOVIC, S.; MIHAILOVIC, N.; GAJIC, B. Heavy metals in soils: Distribution, relationship with soil characteristics and radionuclides and multivariate assessment of contamination sources. Chemosphere, 2008, roč. 72. č. 3, s. 491495. ISS 0045-6535. DRUMMOND, T. G.; HILL, M. G.; BARTON, J. K. Electrochemical DNA sensors. Nature Biotechnology, 2003, roč. 21. č. 10, s. 1192-1199. ISS 1087-0156. DUBERTRET, B. Quantum dots - DNA detectives. Nature Materials, 2005, roč. 4. č. 11, s. 797-798. ISS 1476-1122. DUBREUIL-MAURIZI, C.; VITECEK, J.; MARTY, L.; BRANCIARD, L.; FRETTINGER, P.; WENDEHENNE, D.; MEYER, A. J.; MAUCH, F.; POINSSOT, B. Glutathione Deficiency of the Arabidopsis Mutant pad2-1 Affects Oxidative Stress-Related Events, Defense Gene Expression, and the Hypersensitive Response. Plant Physiology, 2011, roč. 157. č. 4, s. 2000-2012. ISS 0032-0889. EDWARDS, M. R. A.; HETU, M. F.; COLUMBUS, M.; SILVA, A.; LEFEBVRE, D. D. THE EFFECT OF ETHYLENE GLYCOL ON THE PHYTOVOLATILIZATION OF 1,4-DIOXANE. International Journal of Phytoremediation, 2011, roč. 13. č. 7, s. 702-716. ISS 1522-6514. EULGEM, T.; RUSHTON, P. J.; ROBATZEK, S.; SOMSSICH, I. E. The WRKY superfamily of plant transcription factors. Trends in Plant Science, 2000, roč. 5. č. 5, s. 199-206. ISS 1360-1385. EULGEM, T.; SOMSSICH, I. E. Networks of WRKY transcription factors in defense signaling. Current Opinion in Plant Biology, 2007, roč. 10. č. 4, s. 366-371. ISS 1369-5266. FARINATI, S.; DALCORSO, G.; VAROTTO, S.; FURINI, A. The Brassica juncea BjCdR15, an ortholog of Arabidopsis TGA3, is a regulator of cadmium uptake, transport and accumulation in shoots and confers cadmium tolerance in transgenic plants. New Phytologist, 2010, roč. 185. č. 4, s. 964-978. ISS 0028646X. FARMER, E. E. Surface-to-air signals. Nature, 2001, roč. 411. č. 6839, s. 854-856. ISS 0028-0836.

174

FECHT-CHRISTOFFERS, M. M.; BRAUN, H. P.; LEMAITRE-GUILLIER, C.; VANDORSSELAER, A.; HORST, W. J. Effect of Manganese toxicity on the proteome of the leaf apoplast in cowpea. Plant Physiology, 2003, roč. 133. č. 4, s. 1935-1946. ISS 0032-0889. FILIPOVIC-TRAJKOVIC, R.; ILIC, Z. S.; SUNIC, L.; ANDJELKOVIC, S. The potential of different plant species for heavy metals accumulation and distribution. Journal of Food Agriculture & Environment, 2012, roč. 10. č. 1, s. 959-964. ISS 1459-0255. FLORIS, M.; MAHGOUB, H.; LANET, E.; ROBAGLIA, C.; MENAND, B. Posttranscriptional Regulation of Gene Expression in Plants during Abiotic Stress. International Journal of Molecular Sciences, 2009, roč. 10. č. 7, s. 3168-3185. ISS 1661-6596. FOYER, C. H.; BLOOM, A. J.; QUEVAL, G.; NOCTOR, G. Photorespiratory Metabolism: Genes, Mutants, Energetics, and Redox Signaling. Annual Review of Plant Biology. Palo Alto: Annual Reviews, 2009 (vol 60). FOYER, C. H.; LOPEZDELGADO, H.; DAT, J. F.; SCOTT, I. M. Hydrogen peroxideand glutathione-associated mechanisms of acclimatory stress tolerance and signalling. Physiologia Plantarum, 1997, roč. 100. č. 2, s. 241-254. ISS 00319317. FOYER, C. H.; NOCTOR, G. Ascorbate and Glutathione: The Heart of the Redox Hub. Plant Physiology, 2011, roč. 155. č. 1, s. 2-18. ISS 0032-0889. FOYER, C. H.; THEODOULOU, F. L.; DELROT, S. The functions of inter- and intracellular glutathione transport systems in plants. Trends in Plant Science, 2001, roč. 6. č. 10, s. 486-492. ISS 1360-1385. FRASER, J. A.; DAVIS, M. A.; HYNES, M. J. A gene from Aspergillus nidulans with similarity to URE2 of Saccharomyces cerevisiae encodes a glutathione Stransferase which contributes to heavy metal and xenobiotic resistance. Applied and Environmental Microbiology, 2002, roč. 68. č. 6, s. 2802-2808. ISS 00992240. FREESTONE, I.; MEEKS, N.; SAX, M.; HIGGITT, C. The Lycurgus Cup - A Roman nanotechnology. Gold Bulletin, 2007, roč. 40. č. 4, s. 270-277. ISS 0017-1557. FROVA, C. The plant glutathione transferase gene family: genomic structure, functions, expression and evolution. Physiologia Plantarum, 2003, roč. 119. č. 4, s. 469479. ISS 0031-9317. FUSCO, N.; MICHELETTO, L.; DAL CORSO, G.; BORGATO, L.; FURINI, A. Identification of cadmium-regulated genes by cDNA-AFLP in the heavy metal accumulator Brassica juncea L. Journal of Experimental Botany, 2005, roč. 56. č. 421, s. 3017-3027. ISS 0022-0957.

175

GALIOVA, M.; KAISER, J.; NOVOTNY, K.; NOVOTNY, J.; VACULOVIC, T.; LISKA, M.; MALINA, R.; STEJSKAL, K.; ADAM, V.; KIZEK, R. Investigation of heavy-metal accumulation in selected plant samples using laser induced breakdown spectroscopy and laser ablation inductively coupled plasma mass spectrometry. Applied Physics a-Materials Science & Processing, 2008, roč. 93. č. 4, s. 917-922. ISS 0947-8396. GAO, M. J.; ALLARD, G.; BYASS, L.; FLANAGAN, A. M.; SINGH, J. Regulation and characterization of four CBF transcription factors from Brassica napus. Plant Molecular Biology, 2002, roč. 49. č. 5, s. 459-471. ISS 0167-4412. GAO, P.; BAI, X.; YANG, L. A.; LV, D. K.; PAN, X.; LI, Y.; CAI, H.; JI, W.; CHEN, Q.; ZHU, Y. M. osa-MIR393: a salinity- and alkaline stress-related microRNA gene. Molecular Biology Reports, 2011, roč. 38. č. 1, s. 237-242. ISS 03014851. GARCIA, M. N. M.; GIAMMARIA, V.; GRANDELLIS, C.; TELLEZ-INON, M. T.; ULLOA, R. M.; CAPIATI, D. A. Characterization of StABF1, a stressresponsive bZIP transcription factor from Solanum tuberosum L. that is phosphorylated by StCDPK2 in vitro. Planta, 2012, roč. 235. č. 4, s. 761-778. ISS 0032-0935. GARDINER, S. A.; BODDU, J.; BERTHILLER, F.; HAMETNER, C.; STUPAR, R. M.; ADAM, G.; MUEHLBAUER, G. J. Transcriptome Analysis of the BarleyDeoxynivalenol Interaction: Evidence for a Role of Glutathione in Deoxynivalenol Detoxification. Molecular Plant-Microbe Interactions, 2010, roč. 23. č. 7, s. 962-976. ISS 0894-0282. GEIMER, S.; BELICOVA, A.; LEGEN, J.; SLAVIKOVA, S.; HERRMANN, R. G.; KRAJCOVIC, J. Transcriptome analysis of the Euglena gracilis plastid chromosome. Current Genetics, 2009, roč. 55. č. 4, s. 425-438. ISS 0172-8083. GRILL, E.; LOFFLER, S.; WINNACKER, E. L.; ZENK, M. H. PHYTOCHELATINS, THE HEAVY-METAL-BINDING PEPTIDES OF PLANTS, ARE SYNTHESIZED FROM GLUTATHIONE BY A SPECIFIC GAMMAGLUTAMYLCYSTEINE DIPEPTIDYL TRANSPEPTIDASE (PHYTOCHELATIN SYNTHASE). Proceedings of the National Academy of Sciences of the United States of America, 1989, roč. 86. č. 18, s. 6838-6842. ISS 0027-8424. GRILL, E.; WINNACKER, E. L.; ZENK, M. H. PHYTOCHELATINS, A CLASS OF HEAVY-METAL-BINDING PEPTIDES FROM PLANTS, ARE FUNCTIONALLY ANALOGOUS TO METALLOTHIONEINS. Proceedings of the National Academy of Sciences of the United States of America, 1987, roč. 84. č. 2, s. 439-443. ISS 0027-8424. GUDDETI, S.; ZHANG, D. C.; LI, A. L.; LESEBERG, C. H.; KANG, H.; LI, X. G.; ZHAI, W. X.; JOHNS, M. A.; MAO, L. Molecular evolution of the rice miR395 gene family. Cell Research, 2005, roč. 15. č. 8, s. 631-638. ISS 1001-0602.

176

GUERRA, F.; DUPLESSIS, S.; KOHLER, A.; MARTIN, F.; TAPIA, J.; LEBED, P.; ZAMUDIO, F.; GONZALEZ, E. Gene expression analysis of Populus deltoides roots subjected to copper stress. Environmental and Experimental Botany, 2009, roč. 67. č. 2, s. 335-344. ISS 0098-8472. GUNAWARDANA, B.; SINGHAL, N.; JOHNSON, A. Amendments and their combined application for enhanced copper, cadmium, lead uptake by Lolium perenne. Plant and Soil, 2010, roč. 329. č. 1-2, s. 283-294. ISS 0032-079X. GUO, Z. H.; MEGHARAJ, M.; BEER, M.; MING, H.; RAHMAN, M. M.; WU, W. H.; NAIDU, R. Heavy metal impact on bacterial biomass based on DNA analyses and uptake by wild plants in the abandoned copper mine soils. Bioresource Technology, 2009, roč. 100. č. 17, s. 3831-3836. ISS 0960-8524. HA, S. B.; SMITH, A. P.; HOWDEN, R.; DIETRICH, W. M.; BUGG, S.; O'CONNELL, M. J.; GOLDSBROUGH, P. B.; COBBETT, C. S. Phytochelatin synthase genes from arabidopsis and the yeast Schizosaccharomyces pombe. Plant Cell, 1999, roč. 11. č. 6, s. 1153-1163. ISS 1040-4651. HADIDI, A.; CZOSNEK, H.; BARBA, M. DNA microarrays and their potential applications for the detection of plant viruses, viroids, and phytoplasmas. Journal of Plant Pathology, 2004, roč. 86. č. 2, s. 97-104. ISS 1125-4653. HAJDUCH, M.; RAKWAL, R.; AGRAWAL, G. K.; YONEKURA, M.; PRETOVA, A. High-resolution two-dimensional electrophoresis separation of proteins from metal-stressed rice (Oryza sativa L.) leaves: Drastic reductions/fragmentation of ribulose-1,5-bisphosphate carboxylase/oxygenase and induction of stress-related proteins. Electrophoresis, 2001, roč. 22. č. 13, s. 2824-2831. ISS 0173-0835. HALFORD, N. G.; HEY, S. J. Snf1-related protein kinases (SnRKs) act within an intricate network that links metabolic and stress signalling in plants. Biochemical Journal, 2009, roč. 419. č., s. 247-259. ISS 0264-6021. HALL, J. L. Cellular mechanisms for heavy metal detoxification and tolerance. Journal of Experimental Botany, 2002, roč. 53. č. 366, s. 1-11. ISS 0022-0957. HAN, M. Y.; GAO, X. H.; SU, J. Z.; NIE, S. Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules. Nature Biotechnology, 2001, roč. 19. č. 7, s. 631-635. ISS 1087-0156. HANIKENNE, M.; TALKE, I. N.; HAYDON, M. J.; LANZ, C.; NOLTE, A.; MOTTE, P.; KROYMANN, J.; WEIGEL, D.; KRAEMER, U. Evolution of metal hyperaccumulation required cis-regulatory changes and triplication of HMA4. Nature, 2008, roč. 453. č. 7193, s. 391-U44. ISS 0028-0836. HARADA, E.; YAMAGUCHI, Y.; KOIZUMI, N.; SANO, H. Cadmium stress induces production of thiol compounds and transcripts for enzymes involved in sulfur assimilation pathways in Arabidopsis. Journal of Plant Physiology, 2002, roč. 159. č. 4, s. 445-448. ISS 0176-1617.

177

HARMON, A. C.; GRIBSKOV, M.; HARPER, J. F. CDPKs - a kinase for every Ca2+ signal? Trends in Plant Science, 2000, roč. 5. č. 4, s. 154-159. ISS 1360-1385. HASAN, S. A.; FARIDUDDIN, Q.; ALI, B.; HAYAT, S.; AHMAD, A. Cadmium: Toxicity and tolerance in plants. Journal of Environmental Biology, 2009, roč. 30. č. 2, s. 165-174. ISS 0254-8704. HAUN, J. B.; YOON, T. J.; LEE, H.; WEISSLEDER, R. Magnetic nanoparticle biosensors. Wiley Interdisciplinary Reviews-Nanomedicine and Nanobiotechnology, 2010, roč. 2. č. 3, s. 291-304. ISS 1939-5116. HE, L.; HANNON, G. J. MicroRNAs: Small RNAs with a big role in gene regulation (vol 5, pg 522 2004). Nature Reviews Genetics, 2004, roč. 5. č. 8, s. 522-+. ISS 1471-0056. HEISS, S.; WACHTER, A.; BOGS, J.; COBBETT, C.; RAUSCH, T. Phytochelatin synthase (PCS) protein is induced in Brassica juncea leaves after prolonged Cd exposure. Journal of Experimental Botany, 2003, roč. 54. č. 389, s. 1833-1839. ISS 0022-0957. HERBETTE, S.; TACONNAT, L.; HUGOUVIEUX, V.; PIETTE, L.; MAGNIETTE, M. L. M.; CUINE, S.; AUROY, P.; RICHAUD, P.; FORESTIER, C.; BOURGUIGNON, J.; RENOU, J. P.; VAVASSEUR, A.; LEONHARDT, N. Genome-wide transcriptome profiling of the early cadmium response of Arabidopsis roots and shoots. Biochimie, 2006, roč. 88. č. 11, s. 1751-1765. ISS 0300-9084. HIGHTOWER, L. E. HEAT-SHOCK, STRESS PROTEINS, CHAPERONES, AND PROTEOTOXICITY. Cell, 1991, roč. 66. č. 2, s. 191-197. ISS 0092-8674. HINESLY, T. D.; REDBORG, K. E.; PIETZ, R. I.; ZIEGLER, E. L. CADMIUM AND ZINC UPTAKE BY CORN (ZEA-MAYS-L) WITH REPEATED APPLICATIONS OF SEWAGE-SLUDGE. Journal of Agricultural and Food Chemistry, 1984, roč. 32. č. 1, s. 155-163. ISS 0021-8561. HIRATA, K.; TSUJI, N.; MIYAMOTO, K. Biosynthetic regulation of phytochelatins, heavy metal-binding peptides. Journal of Bioscience and Bioengineering, 2005, roč. 100. č. 6, s. 593-599. ISS 1389-1723. HIRSCH, R. E.; LEWIS, B. D.; SPALDING, E. P.; SUSSMAN, M. R. A role for the AKT1 potassium channel in plant nutrition. Science, 1998, roč. 280. č. 5365, s. 918-921. ISS 0036-8075. HOSSAIN, Z.; NOURI, M. Z.; KOMATSU, S. Plant Cell Organelle Proteomics in Response to Abiotic Stress. Journal of Proteome Research, 2012, roč. 11. č. 1, s. 37-48. ISS 1535-3893.

178

HOU, L. F.; WANG, D.; BACCARELLI, A. Environmental chemicals and microRNAs. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis, 2011, roč. 714. č. 1-2, s. 105-112. ISS 0027-5107. HOUDEBINE, L. M. Phytoremediation by poplars. Cahiers Agricultures, 2007, roč. 16. č. 6, s. 498-499. ISS 1166-7699. HOWDEN, R.; COBBETT, C. S. CADMIUM-SENSITIVE MUTANTS OF ARABIDOPSIS-THALIANA. Plant Physiology, 1992, roč. 100. č. 1, s. 100107. ISS 0032-0889. HOWDEN, R.; GOLDSBROUGH, P. B.; ANDERSEN, C. R.; COBBETT, C. S. CADMIUM-SENSITIVE, CAD1 MUTANTS OF ARABIDOPSIS-THALIANA ARE PHYTOCHELATIN DEFICIENT. Plant Physiology, 1995, roč. 107. č. 4, s. 1059-1066. ISS 0032-0889. HU, N.; ZHAO, B. Key genes involved in heavy-metal resistance in Pseudomonas putida CD2. Fems Microbiology Letters, 2007, roč. 267. č. 1, s. 17-22. ISS 0378-1097. HUANG, S. Q.; PENG, J.; QIU, C. X.; YANG, Z. M. Heavy metal-regulated new microRNAs from rice. Journal of Inorganic Biochemistry, 2009, roč. 103. č. 2, s. 282-287. ISS 0162-0134. HUSKA, D.; ADAM, V.; BABULA, P.; KIZEK, R. Plne automatizovana izolace celkove mRNA z in vitro kultivovanych rostlin ve spojeni s elektrochemickou detekci. Chem. Listy, 2009, roč. 103. č. S, s. s167-s171. ISS 0009-2770. clanek IF 0.717 HUSKA, D.; ADAM, V.; TRNKOVA, L.; KIZEK, R. Electrochemical detection of mRNA isolated from plant tissues using of paramagnetic microparticles. Chem. Listy, 2010, roč. 104. č. 3, s. 177-185. ISS 0009-2770. clanek IF 0.717 HUSKA, D.; BALOUN, J.; KRYSTOFOVA, O.; ADAM, V.; ZEHNALEK, J.; BEKLOVA, M.; HAVEL, L.; KIZEK, R. Profiling of stress transcriptome of selected genes in plants treated with heavy metals. Toxicol. Lett., 2009, roč. 189. č. Sp. Iss. IS, s. S161-S161. ISS 0378-4274. meeting abstract IF 3.479 HUSKA, D.; HUBALEK, J.; ADAM, V.; VAJTR, D.; HORNA, A.; TRNKOVA, L.; HAVEL, L.; KIZEK, R. Automated nucleic acids isolation using paramagnetic microparticles coupled with electrochemical detection. Talanta, 2009, roč. 79. č. 2, s. 402-411. ISS 0039-9140. HUSKA, D.; KRIZKOVA, S.; ADAM, V.; HUBALEK, J.; TRNKOVA, L.; PRUSA, R.; HAVEL, L.; KIZEK, R. Paramagnetic beads coupled with electrochemical detection as a tool to investigate transcriptome. Tumor Biol., 2007, roč. 28. č. Suppl. 1, s. 124-124. ISS 1010-4283. meeting abstract IF 2.481

179

HUSKA, D.; KRYSTOFOVA, O.; ADAM, V.; ZEHNALEK, J.; BABULA, P.; HAVEL, L.; TRNKOVA, L.; KIZEK, R. Paramagnetic particles with specific sequences of nucleic acids as tools for detection heavy-metal-stress-induced genes' expression in plants. FEBS J., 2009, roč. 276. č. Suppl. 1, s. 281-281. ISS 1742-464X. meeting abstract IF 3.042 INDURI, B. R.; ELLIS, D. R.; SLAVOV, G. T.; YIN, T. M.; ZHANG, X. Y.; MUCHERO, W.; TUSKAN, G. A.; DIFAZIO, S. P. Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus. Tree Physiology, 2012, roč. 32. č. 5, s. 626-638. ISS 0829-318X. JABEEN, R.; AHMAD, A.; IQBAL, M. Phytoremediation of Heavy Metals: Physiological and Molecular Mechanisms. Botanical Review, 2009, roč. 75. č. 4, s. 339-364. ISS 0006-8101. JAGADEESWARAN, G.; SAINI, A.; SUNKAR, R. Biotic and abiotic stress downregulate miR398 expression in Arabidopsis. Planta, 2009, roč. 229. č. 4, s. 1009-1014. ISS 0032-0935. JAKOBY, M.; WEISSHAAR, B.; DROGE-LASER, W.; VICENTE-CARBAJOSA, J.; TIEDEMANN, J.; KROJ, T.; PARCY, F.; B, Z. I. P. R. G. bZIP transcription factors in Arabidopsis. Trends in Plant Science, 2002, roč. 7. č. 3, s. 106-111. ISS 1360-1385. JASINSKI, M.; SUDRE, D.; SCHANSKER, G.; SCHELLENBERG, M.; CONSTANT, S.; MARTINOIA, E.; BOVET, L. AtOSA1, a member of the Abc1-like family, as a new factor in cadmium and oxidative stress response. Plant Physiology, 2008, roč. 147. č. 2, s. 719-731. ISS 0032-0889. JIANG, C. Y.; SHENG, X. F.; QIAN, M.; WANG, Q. Y. Isolation and characterization of a heavy metal-resistant Burkholderia sp from heavy metal-contaminated paddy field soil and its potential in promoting plant growth and heavy metal accumulation in metal-polluted soil. Chemosphere, 2008, roč. 72. č. 2, s. 157164. ISS 0045-6535. JIN, L. G.; LI, H.; LIU, J. Y. Molecular Characterization of Three Ethylene Responsive Element Binding Factor Genes from Cotton. Journal of Integrative Plant Biology, 2010, roč. 52. č. 5, s. 485-495. ISS 1672-9072. JORRIN, J. V.; MALDONADO, A. M.; CASTILLEJO, M. A. Plant proteome analysis: A 2006 update. Proteomics, 2007, roč. 7. č. 16, s. 2947-2962. ISS 1615-9853. KANG, H. G.; SINGH, K. B. Characterization of salicylic acid-responsive, Arabidopsis Dof domain proteins: overexpression of OBP3 leads to growth defects. Plant Journal, 2000, roč. 21. č. 4, s. 329-339. ISS 0960-7412. KARL, T.; GUENTHER, A.; TURNIPSEED, A.; PATTON, E. G.; JARDINE, K. Chemical sensing of plant stress at the ecosystem scale. Biogeosciences, 2008, roč. 5. č. 5, s. 1287-1294. ISS 1726-4170.

180

KARPINSKI, S.; ESCOBAR, C.; KARPINSKA, B.; CREISSEN, G.; MULLINEAUX, P. M. Photosynthetic electron transport regulates the expression of cytosolic ascorbate peroxidase genes in Arabidopsis during excess light stress. Plant Cell, 1997, roč. 9. č. 4, s. 627-640. ISS 1040-4651. KARUPPANAPANDIAN, T.; MOON, J. C.; KIM, C.; MANOHARAN, K.; KIM, W. Reactive oxygen species in plants: their generation, signal transduction, and scavenging mechanisms. Australian Journal of Crop Science, 2011, roč. 5. č. 6, s. 709-725. ISS 1835-2693. KASSAHN, K. S. Microarrays for comparative and ecological genomics: beyond single-species applications of array technologies. Journal of Fish Biology, 2008, roč. 72. č. 9, s. 2407-2434. ISS 0022-1112. KAWASHIMA, C. G.; MATTHEWMAN, C. A.; HUANG, S. Q.; LEE, B. R.; YOSHIMOTO, N.; KOPRIVOVA, A.; RUBIO-SOMOZA, I.; TODESCO, M.; RATHJEN, T.; SAITO, K.; TAKAHASHI, H.; DALMAY, T.; KOPRIVA, S. Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. Plant Journal, 2011, roč. 66. č. 5, s. 863-876. ISS 0960-7412. KHOT, L. R.; SANKARAN, S.; MAJA, J. M.; EHSANI, R.; SCHUSTER, E. W. Applications of nanomaterials in agricultural production and crop protection: A review. Crop Protection, 2012, roč. 35. č., s. 64-70. ISS 0261-2194. KIDO, E. A.; BARBOSA, P. K. D.; NETO, J.; PANDOLFI, V.; HOULLOU-KIDO, L. M.; CROVELLA, S.; MOLINA, C.; KAHL, G.; BENKO-ISEPPON, A. M. Identification of Plant Protein Kinases in Response to Abiotic and Biotic Stresses Using SuperSAGE. Current Protein & Peptide Science, 2011, roč. 12. č. 7, s. 643-656. ISS 1389-2037. KIECHLE, F. L.; HOLLAND-STALEY, C. A. Genomics, transcriptomics, proteomics, and numbers. Archives of Pathology & Laboratory Medicine, 2003, roč. 127. č. 9, s. 1089-1097. ISS 0003-9985. KIEFFER, P.; DOMMES, J.; HOFFMANN, L.; HAUSMAN, J. F.; RENAUT, J. Quantitative changes in protein expression of cadmium-exposed poplar plants. Proteomics, 2008, roč. 8. č. 12, s. 2514-2530. ISS 1615-9853. KIELBOWICZ-MATUK, A. Involvement of plant C2H2-type zinc finger transcription factors in stress responses. Plant Science, 2012, roč. 185. č., s. 78-85. ISS 01689452. KIM, C. J.; JEONG, J. K.; PARK, M.; PARK, T. S.; PARK, T. C.; NAMKOONG, S. E.; PARK, J. S. HPV oligonucleotide microarray-based detection of HPV genotypes in cervical neoplastic lesions. Gynecologic Oncology, 2003, roč. 89. č. 2, s. 210-217. ISS 0090-8258.

181

KIM, D.-Y.; BOVET, L.; MAESHIMA, M.; MARTINOIA, E.; LEE, Y. The ABC transporter AtPDR8 is a cadmium extrusion pump conferring heavy metal resistance. Plant Journal, 2007, roč. 50. č. 2, s. 207-218. ISS 0960-7412. KIM, D. Y.; BOVET, L.; MAESHIMA, M.; MARTINOIA, E.; LEE, Y. The ABC transporter AtPDR8 is a cadmium extrusion pump conferring heavy metal resistance. Plant Journal, 2007, roč. 50. č. 2, s. 207-218. ISS 0960-7412. KIM, S.; KANG, J. Y.; CHO, D. I.; PARK, J. H.; KIM, S. Y. ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant Journal, 2004, roč. 40. č. 1, s. 75-87. ISS 0960-7412. KOH, I.; JOSEPHSON, L. Magnetic Nanoparticle Sensors. Sensors, 2009, roč. 9. č. 10, s. 8130-8145. ISS 1424-8220. KOSOVA, K.; VITAMVAS, P.; PRASIL, I. T.; RENAUT, J. Plant proteome changes under abiotic stress - Contribution of proteomics studies to understanding plant stress response. Journal of Proteomics, 2011, roč. 74. č. 8, s. 1301-1322. ISS 1874-3919. KOVALCHUK, I.; TITOV, V.; HOHN, B.; KOVALCHUKA, O. Transcriptome profiling reveals similarities and differences in plant responses to cadmium and lead. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis, 2005, roč. 570. č. 2, s. 149-161. ISS 0027-5107. KRESLAVSKI, V. D.; LOS, D. A.; ALLAKHVERDIEV, S. I.; KUZNETSOV, V. V. Signaling Role of Reactive Oxygen Species in Plants under Stress. Russian Journal of Plant Physiology, 2012, roč. 59. č. 2, s. 141-154. ISS 1021-4437. KRYSTOFOVA, O.; ZITKA, O.; KRIZKOVA, S.; HYNEK, D.; SHESTIVSKA, V.; ADAM, V.; HUBALEK, J.; MACKOVA, M.; MACEK, T.; ZEHNALEK, J.; BABULA, P.; HAVEL, L.; KIZEK, R. Accumulation of Cadmium by Transgenic Tobacco Plants (Nicotiana tabacum L.) Carrying Yeast Metallothionein Gene Revealed by Electrochemistry. International Journal of Electrochemical Science, 2012, roč. 7. č. 2, s. 886-907. ISS 1452-3981. KULIK, A.; WAWER, I.; KRZYWINSKA, E.; BUCHOLC, M.; DOBROWOLSKA, G. SnRK2 Protein Kinases-Key Regulators of Plant Response to Abiotic Stresses. Omics-a Journal of Integrative Biology, 2011, roč. 15. č. 12, s. 859-872. ISS 1536-2310. KUMAR, P.; DUSHENKOV, V.; MOTTO, H.; RASKIN, I. PHYTOEXTRACTION THE USE OF PLANTS TO REMOVE HEAVY-METALS FROM SOILS. Environmental Science & Technology, 1995, roč. 29. č. 5, s. 1232-1238. ISS 0013-936X. KUNO, M. SynthesisIntroductory Nanoscience. New York: Garland Science, Taylor & Francis, 2012.

182

KUPPER, H.; KRONECK, P. M. H. Heavy metal uptake by plants and cyanobacteria. In: SIGEL, A.; SIGEL H.; SIGEL R. K. O., eds. Metal Ions in Biological Systems, Vol 44: Biogeochemistry, Availability, and Transport of Metals in the Environment, 2005 (vol 44). LAGRIFFOUL, A.; MOCQUOT, B.; MENCH, M.; VANGRONSVELD, J. Cadmium toxicity effects on growth, mineral and chlorophyll contents, and activities of stress related enzymes in young maize plants (Zea mays L.). Plant and Soil, 1998, roč. 200. č. 2, s. 241-250. ISS 0032-079X. LAMB, C.; DIXON, R. A. The oxidative burst in plant disease resistance. Annual Review of Plant Physiology and Plant Molecular Biology, 1997, roč. 48. č., s. 251-275. ISS 1040-2519. LE MARTRET, B.; POAGE, M.; SHIEL, K.; NUGENT, G. D.; DIX, P. J. Tobacco chloroplast transformants expressing genes encoding dehydroascorbate reductase, glutathione reductase, and glutathione-S-transferase, exhibit altered anti-oxidant metabolism and improved abiotic stress tolerance. Plant Biotechnology Journal, 2011, roč. 9. č. 6, s. 661-673. ISS 1467-7644. LEE, R. M.; TRANEL, P. J. Utilization of DNA microarrays in weed science research. Weed Science, 2008, roč. 56. č. 2, s. 283-289. ISS 0043-1745. LEE, S.; MOON, J. S.; KO, T. S.; PETROS, D.; GOLDSBROUGH, P. B.; KORBAN, S. S. Overexpression of Arabidopsis phytochelatin synthase paradoxically leads to hypersensitivity to cadmium stress. Plant Physiology, 2003, roč. 131. č. 2, s. 656-663. ISS 0032-0889. LEE, S. C.; LUAN, S. ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant Cell and Environment, 2012, roč. 35. č. 1, s. 53-60. ISS 0140-7791. LI, J.; ZOU, G. Z.; HU, X. F.; ZHANG, X. L. Electrochemistry of thiol-capped CdTe quantum dots and its sensing application. Journal of Electroanalytical Chemistry, 2009, roč. 625. č. 1, s. 88-91. ISS 1572-6657. LI,

Y. F.; ZHENG, Y.; ADDO-QUAYE, C.; ZHANG, L.; SAINI, A.; JAGADEESWARAN, G.; AXTELL, M. J.; ZHANG, W. X.; SUNKAR, R. Transcriptome-wide identification of microRNA targets in rice. Plant Journal, 2010, roč. 62. č. 5, s. 742-759. ISS 0960-7412.

LINDQUIST, S.; CRAIG, E. A. THE HEAT-SHOCK PROTEINS. Annual Review of Genetics, 1988, roč. 22. č., s. 631-677. ISS 0066-4197. LIU, F. J.; LAURENT, S.; FATTAHI, H.; ELST, L. V.; MULLER, R. N. Superparamagnetic nanosystems based on iron oxide nanoparticles for biomedical imaging. Nanomedicine, 2011, roč. 6. č. 3, s. 519-528. ISS 17435889.

183

LIU, K.; SUN, J.; SONG, Y. G.; LIU, B.; XU, Y. K.; ZHANG, S. X.; TIAN, Q.; LIU, Y. Superoxide, hydrogen peroxide and hydroxyl radical in D1/D2/cytochrome b559 Photosystem II reaction center complex. Photosynthesis Research, 2004, roč. 81. č. 1, s. 41-47. ISS 0166-8595. LIU, Y. J.; YUAN, Y.; LIU, Y. Y.; LIU, Y.; FU, J. J.; ZHENG, J.; WANG, G. Y. Gene families of maize glutathione-ascorbate redox cycle respond differently to abiotic stresses. Journal of Plant Physiology, 2012, roč. 169. č. 2, s. 183-192. ISS 0176-1617. LUDERS, A.; MULLER, C.; BOONROD, K.; KRCZAL, G.; ZIEGLER, C. Tomato bushy stunt viruses (TBSV) in nanotechnology investigated by scanning force and scanning electron microscopy. Colloids and Surfaces B-Biointerfaces, 2012, roč. 91. č., s. 154-161. ISS 0927-7765. LUX, A.; MARTINKA, M.; VACULIK, M.; WHITE, P. J. Root responses to cadmium in the rhizosphere: a review. Journal of Experimental Botany, 2011, roč. 62. č. 1, s. 21-37. ISS 0022-0957. MA, K. X.; CHEN, G. W.; LIU, D. Z. cDNA cloning of heat shock protein 90 gene and protein expression pattern in response to heavy metal exposure and thermal stress in planarian Dugesia japonica. Molecular Biology Reports, 2012, roč. 39. č. 6, s. 7203-7210. ISS 0301-4851. MAKSYMIEC, W. Signaling responses in plants to heavy metal stress. Acta Physiologiae Plantarum, 2007, roč. 29. č. 3, s. 177-187. ISS 0137-5881. MARDIS, E. R. Next-generation DNA sequencing methods. Annual Review of Genomics and Human Genetics, 2008 (vol 9). MARQUES, A.; RANGEL, A.; CASTRO, P. M. L. Remediation of Heavy Metal Contaminated Soils: Phytoremediation as a Potentially Promising Clean-Up Technology. Critical Reviews in Environmental Science and Technology, 2009, roč. 39. č. 8, s. 622-654. ISS 1064-3389. MARTIN-ORTIGOSA, S.; VALENSTEIN, J. S.; SUN, W.; MOELLER, L.; FANG, N.; TREWYN, B. G.; LIN, V. S. Y.; WANG, K. Application of Nanotechnology in Plant Sciences: Efficient Introduction of Nanoparticles to Plant Cells. In Vitro Cellular & Developmental Biology-Animal, 2012, roč. 48. č., s. 2-2. ISS 10712690. MAY, M. J.; VERNOUX, T.; LEAVER, C.; VAN MONTAGU, M.; INZE, D. Glutathione homeostasis in plants: implications for environmental sensing and plant development. Journal of Experimental Botany, 1998, roč. 49. č. 321, s. 649-667. ISS 0022-0957. MELO, L. C. A.; ALLEONI, L. R. F.; CARVALHO, G.; AZEVEDO, R. A. Cadmiumand barium-toxicity effects on growth and antioxidant capacity of soybean (Glycine max L.) plants, grown in two soil types with different physicochemical

184

properties. Journal of Plant Nutrition and Soil Science, 2011, roč. 174. č. 5, s. 847-859. ISS 1436-8730. MEMON, A. R.; SCHRODER, P. Implications of metal accumulation mechanisms to phytoremediation. Environmental Science and Pollution Research, 2009, roč. 16. č. 2, s. 162-175. ISS 0944-1344. MICHALET, X.; PINAUD, F. F.; BENTOLILA, L. A.; TSAY, J. M.; DOOSE, S.; LI, J. J.; SUNDARESAN, G.; WU, A. M.; GAMBHIR, S. S.; WEISS, S. Quantum dots for live cells, in vivo imaging, and diagnostics. Science, 2005, roč. 307. č. 5709, s. 538-544. ISS 0036-8075. MITTLER, R. Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science, 2002, roč. 7. č. 9, s. 405-410. ISS 1360-1385. MITTLER, R. Abiotic stress, the field environment and stress combination. Trends in Plant Science, 2006, roč. 11. č. 1, s. 15-19. ISS 1360-1385. MITTLER, R.; VANDERAUWERA, S.; GOLLERY, M.; VAN BREUSEGEM, F. Reactive oxygen gene network of plants. Trends in Plant Science, 2004, roč. 9. č. 10, s. 490-498. ISS 1360-1385. MORI, I. C.; MURATA, Y.; YANG, Y. Z.; MUNEMASA, S.; WANG, Y. F.; ANDREOLI, S.; TIRIAC, H.; ALONSO, J. M.; HARPER, J. F.; ECKER, J. R.; KWAK, J. M.; SCHROEDER, J. I. CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca2+-permeable channels and stomatal closure. Plos Biology, 2006, roč. 4. č. 10, s. 1749-1762. ISS 1544-9173. MULLINEAUX, P. M.; RAUSCH, T. Glutathione, photosynthesis and the redox regulation of stress-responsive gene expression. Photosynthesis Research, 2005, roč. 86. č. 3, s. 459-474. ISS 0166-8595. NAJMANOVA, J.; NEUMANNOVA, E.; LEONHARDT, T.; ZITKA, O.; KIZEK, R.; MACEK, T.; MACKOVA, M.; KOTRBA, P. Cadmium-induced production of phytochelatins and speciation of intracellular cadmium in organs of Linum usitatissimum seedlings. Industrial Crops and Products, 2012, roč. 36. č. 1, s. 536-542. ISS 0926-6690. NAKASHIMA, K.; TAKASAKI, H.; MIZOI, J.; SHINOZAKI, K.; YAMAGUCHISHINOZAKI, K. NAC transcription factors in plant abiotic stress responses. Biochimica Et Biophysica Acta-Gene Regulatory Mechanisms, 2012, roč. 1819. č. 2, s. 97-103. ISS 1874-9399. NALLUR, G.; MARRERO, R.; LUO, C. H.; KRISHNA, R. M.; BECHTEL, P. E.; SHAO, W. P.; RAY, M.; WILTSHIRE, S.; FANG, L. H.; HUANG, H.; LIU, C. G.; SUN, L.; SAWYER, J. R.; KINGSMORE, S. F.; SCHWEITZER, B.; XIA, J. Protein and nucleic acid detection by rolling circle amplification on gel-based microarrays. Biomedical Microdevices, 2003, roč. 5. č. 2, s. 115-123. ISS 13872176.

185

NARUSAKA, Y.; NAKASHIMA, K.; SHINWARI, Z. K.; SAKUMA, Y.; FURIHATA, T.; ABE, H.; NARUSAKA, M.; SHINOZAKI, K.; YAMAGUCHISHINOZAKI, K. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant Journal, 2003, roč. 34. č. 2, s. 137148. ISS 0960-7412. NEILL, S.; DESIKAN, R.; HANCOCK, J. Hydrogen peroxide signalling. Current Opinion in Plant Biology, 2002, roč. 5. č. 5, s. 388-395. ISS 1369-5266. NEUBERGER, T.; SCHOPF, B.; HOFMANN, H.; HOFMANN, M.; VON RECHENBERG, B. Superparamagnetic nanoparticles for biomedical applications: Possibilities and limitations of a new drug delivery system. Journal of Magnetism and Magnetic Materials, 2005, roč. 293. č. 1, s. 483-496. ISS 0304-8853. NEUMANN, D.; LICHTENBERGER, O.; GUNTHER, D.; TSCHIERSCH, K.; NOVER, L. HEAT-SHOCK PROTEINS INDUCE HEAVY-METAL TOLERANCE IN HIGHER-PLANTS. Planta, 1994, roč. 194. č. 3, s. 360-367. ISS 0032-0935. NOCTOR, G.; ARISI, A. C. M.; JOUANIN, L.; KUNERT, K. J.; RENNENBERG, H.; FOYER, C. H. Glutathione: biosynthesis, metabolism and relationship to stress tolerance explored in transformed plants. Journal of Experimental Botany, 1998, roč. 49. č. 321, s. 623-647. ISS 0022-0957. NOCTOR, G.; FOYER, C. H. Ascorbate and glutathione: Keeping active oxygen under control. Annual Review of Plant Physiology and Plant Molecular Biology, 1998, roč. 49. č., s. 249-279. ISS 1040-2519. NOCTOR, G.; MHAMDI, A.; CHAOUCH, S.; HAN, Y.; NEUKERMANS, J.; MARQUEZ-GARCIA, B.; QUEVAL, G.; FOYER, C. H. Glutathione in plants: an integrated overview. Plant Cell and Environment, 2012, roč. 35. č. 2, s. 454484. ISS 0140-7791. OHKAMA-OHTSU, N.; FUKUYAMA, K.; OLIVER, D. J. Roles of gamma-Glutamyl Transpeptidase and gamma-Glutamyl Cyclotransferase in Glutathione and Glutathione-Conjugate Metabolism in Plants. In: JACQUOT, J. P., ed. Advances in Botanical Research: Oxidative Stress and Redox Regulation in Plants, Vol 52. London: Academic Press Ltd-Elsevier Science Ltd, 2009 (vol 52). OHKAMA-OHTSU, N.; OIKAWA, A.; ZHAO, P.; XIANG, C.; SAITO, K.; OLIVER, D. J. A gamma-Glutamyl Transpeptidase-Independent Pathway of Glutathione Catabolism to Glutamate via 5-Oxoproline in Arabidopsis. Plant Physiology, 2008, roč. 148. č. 3, s. 1603-1613. ISS 0032-0889. OHKAMA-OHTSU, N.; RADWAN, S.; PETERSON, A.; ZHAO, P.; BADR, A. F.; XIANG, C. B.; OLIVER, D. J. Characterization of the extracellular gamma-

186

glutamyl transpeptidases, GGT1 and GGT2, in Arabidopsis. Plant Journal, 2007, roč. 49. č. 5, s. 865-877. ISS 0960-7412. OHKAMA-OHTSU, N.; ZHAO, P.; XIANG, C. B.; OLIVER, D. J. Glutathione conjugates in the vacuole are degraded by gamma-glutamyl transpeptidase GGT3 in Arabidopsis. Plant Journal, 2007, roč. 49. č. 5, s. 878-888. ISS 09607412. OK, Y. S.; USMAN, A. R. A.; LEE, S. S.; ABD EL-AZEEM, S. A. M.; CHOI, B.; HASHIMOTO, Y.; YANG, J. E. Effects of rapeseed residue on lead and cadmium availability and uptake by rice plants in heavy metal contaminated paddy soil. Chemosphere, 2011, roč. 85. č. 4, s. 677-682. ISS 0045-6535. OLOWOYO, J. O.; OKEDEYI, O. O.; MKOLO, N. M.; LION, G. N.; MDAKANE, S. T. R. Uptake and translocation of heavy metals by medicinal plants growing around a waste dump site in Pretoria, South Africa. South African Journal of Botany, 2012, roč. 78. č., s. 116-121. ISS 0254-6299. ORTIZ, D. F.; KREPPEL, L.; SPEISER, D. M.; SCHEEL, G.; MCDONALD, G.; OW, D. W. HEAVY-METAL TOLERANCE IN THE FISSION YEAST REQUIRES AN ATP-BINDING CASSETTE-TYPE VACUOLAR MEMBRANE TRANSPORTER. Embo Journal, 1992, roč. 11. č. 10, s. 3491-3499. ISS 02614189. ORTIZ, D. F.; RUSCITTI, T.; MCCUE, K. F.; OW, D. W. TRANSPORT OF METALBINDING PEPTIDES BY HMT1, A FISSION YEAST ABC-TYPE VACUOLAR MEMBRANE-PROTEIN. Journal of Biological Chemistry, 1995, roč. 270. č. 9, s. 4721-4728. ISS 0021-9258. OVERMYER, K.; BROSCHE, M.; KANGASJARVI, J. Reactive oxygen species and hormonal control of cell death. Trends in Plant Science, 2003, roč. 8. č. 7, s. 335-342. ISS 1360-1385. PADMAVATHIAMMA, P. K.; LI, L. Y. Phytoremediation technology: Hyperaccumulation metals in plants. Water Air and Soil Pollution, 2007, roč. 184. č. 1-4, s. 105-126. ISS 0049-6979. PAL, M.; HORVATH, E.; JANDA, T.; PALDI, E.; SZALAI, G. Physiological changes and defense mechanisms induced by cadmium stress in maize. Journal of Plant Nutrition and Soil Science-Zeitschrift Fur Pflanzenernahrung Und Bodenkunde, 2006, roč. 169. č. 2, s. 239-246. ISS 1436-8730. PAL, R.; RAI, J. P. N. Phytochelatins: Peptides Involved in Heavy Metal Detoxification. Applied Biochemistry and Biotechnology, 2010, roč. 160. č. 3, s. 945-963. ISS 0273-2289. PALECEK, E. Fifty Years of Nucleic Acid Electrochemistry. Electroanalysis, 2009, roč. 21. č. 3-5, s. 239-251. ISS 1040-0397.

187

PAPOYAN, A.; KOCHIAN, L. V. Identification of Thlaspi caerulescens genes that may be involved in heavy metal hyperaccumulation and tolerance. Characterization of a novel heavy metal transporting ATPase. Plant Physiology, 2004, roč. 136. č. 3, s. 3814-3823. ISS 0032-0889. PARISET, L.; CHILLEMI, G.; BONGIORNI, S.; SPICA, V. R.; VOLENTINI, A. Microarrays and high-throughput transcriptomic analysis in species with incomplete availability of genomic sequences. New Biotechnology, 2009, roč. 25. č. 5, s. 272-279. ISS 1871-6784. PARK, J.; SONG, W. Y.; KO, D.; EOM, Y.; HANSEN, T. H.; SCHILLER, M.; LEE, T. G.; MARTINOIA, E.; LEE, Y. The phytochelatin transporters AtABCC1 and AtABCC2 mediate tolerance to cadmium and mercury. Plant Journal, 2012, roč. 69. č. 2, s. 278-288. ISS 0960-7412. PARK, S. J.; TATON, T. A.; MIRKIN, C. A. Array-based electrical detection of DNA with nanoparticle probes. Science, 2002, roč. 295. č. 5559, s. 1503-1506. ISS 0036-8075. PARRY, G.; CALDERON-VILLALOBOS, L. I.; PRIGGE, M.; PERET, B.; DHARMASIRI, S.; ITOH, H.; LECHNER, E.; GRAY, W. M.; BENNETT, M.; ESTELLE, M. Complex regulation of the TIR1/AFB family of auxin receptors. Proceedings of the National Academy of Sciences of the United States of America, 2009, roč. 106. č. 52, s. 22540-22545. ISS 0027-8424. PEARSON, G.; ROBINSON, F.; GIBSON, T. B.; XU, B. E.; KARANDIKAR, M.; BERMAN, K.; COBB, M. H. Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocrine Reviews, 2001, roč. 22. č. 2, s. 153-183. ISS 0163-769X. PELLINEN, R.; PALVA, T.; KANGASJARVI, J. Subcellular localization of ozoneinduced hydrogen peroxide production in birch (Betula pendula) leaf cells. Plant Journal, 1999, roč. 20. č. 3, s. 349-356. ISS 0960-7412. PENG, H.; ZHANG, J. Plant genomic DNA methylation in response to stresses: Potential applications and challenges in plant breeding. Progress in Natural Science, 2009, roč. 19. č. 9, s. 1037-1045. ISS 1002-0071. PERALES-VELA, H. V.; PENA-CASTRO, J. M.; CANIZARES-VILLANUEVA, R. O. Heavy metal detoxification in eukaryotic microalgae. Chemosphere, 2006, roč. 64. č. 1, s. 1-10. ISS 0045-6535. PERALTA-VIDEA, J. R.; LOPEZ, M. L.; NARAYAN, M.; SAUPE, G.; GARDEATORRESDEY, J. The biochemistry of environmental heavy metal uptake by plants: Implications for the food chain. International Journal of Biochemistry & Cell Biology, 2009, roč. 41. č. 8-9, s. 1665-1677. ISS 1357-2725. PERIS, M.; RECATALA, L.; MICO, C.; SANCHEZ, R.; SANCHEZ, J. Increasing the knowledge of heavy metal contents and sources in agricultural soils of the

188

European Mediterranean region. Water Air and Soil Pollution, 2008, roč. 192. č. 1-4, s. 25-37. ISS 0049-6979. PITERKOVA, J.; TOMANKOVA, K.; LUHOVA, L.; PETRIVALSKY, M.; PEC, P. Oxidative stress: Localisation of reactive oxygen species formation and degradation in plant tissue. Chemicke Listy, 2005, roč. 99. č. 7, s. 455-466. ISS 0009-2770. PRASAD, M. N. V. Cadmium toxicity and tolerance in vascular plants. Environmental and Experimental Botany, 1995, roč. 35. č. 4, s. 525-545. ISS 0098-8472. PRASEK, J.; HUSKA, D.; JASEK, O.; ZAJICKOVA, L.; TRNKOVA, L.; ADAM, V.; KIZEK, R.; HUBALEK, J. Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids. Nanoscale Research Letters, 2011, roč. 6. č., s. ISS 1931-7573. QUEVAL, G.; THOMINET, D.; VANACKER, H.; MIGINIAC-MASLOW, M.; GAKIERE, B.; NOCTOR, G. H2O2-Activated Up-Regulation of Glutathione in Arabidopsis Involves Induction of Genes Encoding Enzymes Involved in Cysteine Synthesis in the Chloroplast. Molecular Plant, 2009, roč. 2. č. 2, s. 344-356. ISS 1674-2052. RAI, M.; INGLE, A. Role of nanotechnology in agriculture with special reference to management of insect pests. Applied Microbiology and Biotechnology, 2012, roč. 94. č. 2, s. 287-293. ISS 0175-7598. RAI, P. K. Heavy metal pollution in aquatic ecosystems and its phytoremediation using wetland plants: An ecosustainable approach. International Journal of Phytoremediation, 2008, roč. 10. č. 2, s. 133-160. ISS 1522-6514. RAMOS, I.; ESTEBAN, E.; LUCENA, J. J.; GARATE, A. Cadmium uptake and subcellular distribution in plants of Lactuca sp Cd-Mn interaction. Plant Science, 2002, roč. 162. č. 5, s. 761-767. ISS 0168-9452. RAMSAY, G. DNA chips: State-of-the-art. Nature Biotechnology, 1998, roč. 16. č. 1, s. 40-44. ISS 1087-0156. RANIERI, A.; CASTAGNA, A.; SCEBBA, F.; CARERI, M.; ZAGNONI, I.; PREDIERI, G.; PAGLIARI, M.; DI TOPPI, L. S. Oxidative stress and phytochelatin characterisation in bread wheat exposed to cadmium excess. Plant Physiology and Biochemistry, 2005, roč. 43. č. 1, s. 45-54. ISS 0981-9428. RASCIO, N.; NAVARI-IZZO, F. Heavy metal hyperaccumulating plants: How and why do they do it? And what makes them so interesting? Plant Science, 2011, roč. 180. č. 2, s. 169-181. ISS 0168-9452. RASKIN, I.; SMITH, R. D.; SALT, D. E. Phytoremediation of metals: Using plants to remove pollutants from the environment. Current Opinion in Biotechnology, 1997, roč. 8. č. 2, s. 221-226. ISS 0958-1669.

189

RAY, P. D.; HUANG, B. W.; TSUJI, Y. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cellular Signalling, 2012, roč. 24. č. 5, s. 981-990. ISS 0898-6568. RENNENBERG, H. GLUTATHIONE METABOLISM AND POSSIBLE BIOLOGICAL ROLES IN HIGHER-PLANTS. Phytochemistry, 1982, roč. 21. č. 12, s. 2771-2781. ISS 0031-9422. RIGOLA, D.; FIERS, M.; VURRO, E.; AARTS, M. G. M. The heavy metal hyperaccumulator Thlaspi caerulescens expresses many species-specific genes, as identified by comparative expressed sequence tag analysis. New Phytologist, 2006, roč. 170. č. 4, s. 753-765. ISS 0028-646X. RIVETTA, A.; NEGRINI, N.; COCUCCI, M. Involvement of Ca2+-calmodulin in Cd2+ toxicity during the early phases of radish (Raphanus sativus L) seed germination. Plant Cell and Environment, 1997, roč. 20. č. 5, s. 600-608. ISS 0140-7791. ROBATZEK, S.; SOMSSICH, I. E. A new member of the Arabidopsis WRKY transcription factor family, AtWRKY6, is associated with both senescence- and defence-related processes. Plant Journal, 2001, roč. 28. č. 2, s. 123-133. ISS 0960-7412. ROBATZEK, S.; SOMSSICH, I. E. Targets of AtWRKY6 regulation during plant senescence and pathogen defense. Genes & Development, 2002, roč. 16. č. 9, s. 1139-1149. ISS 0890-9369. ROELFSEMA, M. R. G.; HEDRICH, R.; GEIGER, D. Anion channels: master switches of stress responses. Trends in Plant Science, 2012, roč. 17. č. 4, s. 221-229. ISS 1360-1385. ROELOFS, D.; AARTS, M. G. M.; SCHAT, H.; VAN STRAALEN, N. M. Functional ecological genomics to demonstrate general and specific responses to abiotic stress. Functional Ecology, 2008, roč. 22. č. 1, s. 8-18. ISS 0269-8463. ROSI, N. L.; MIRKIN, C. A. Nanostructures in biodiagnostics. Chemical Reviews, 2005, roč. 105. č. 4, s. 1547-1562. ISS 0009-2665. ROUHIER, N.; LEMAIRE, S. D.; JACQUOT, J. P. The role of glutathione in photosynthetic organisms: Emerging functions for glutaredoxins and glutathionylation. Annual Review of Plant Biology. Palo Alto: Annual Reviews, 2008 (vol 59). RYVOLOVA, M.; CHOMOUCKA, J.; JANU, L.; DRBOHLAVOVA, J.; ADAM, V.; HUBALEK, J.; KIZEK, R. Biotin-modified glutathione as a functionalized coating for bioconjugation of CdTe-based quantum dots. Electrophoresis, 2011, roč. 32. č. 13, s. 1619-1622. ISS 0173-0835.

190

SARIKAYA, M.; TAMERLER, C.; JEN, A. K. Y.; SCHULTEN, K.; BANEYX, F. Molecular biomimetics: nanotechnology through biology. Nature Materials, 2003, roč. 2. č. 9, s. 577-585. ISS 1476-1122. SCHUTZENDUBEL, A.; POLLE, A. Plant responses to abiotic stresses: heavy metalinduced oxidative stress and protection by mycorrhization. Journal of Experimental Botany, 2002, roč. 53. č. 372, s. 1351-1365. ISS 0022-0957. SEEMAN, N. C. DNA in a material world. Nature, 2003, roč. 421. č. 6921, s. 427-431. ISS 0028-0836. SEIDEL, M.; NIESSNER, R. Automated analytical microarrays: a critical review. Analytical and Bioanalytical Chemistry, 2008, roč. 391. č. 5, s. 1521-1544. ISS 1618-2642. SEKI, M.; NARUSAKA, M.; ABE, H.; KASUGA, M.; YAMAGUCHI-SHINOZAKI, K.; CARNINCI, P.; HAYASHIZAKI, Y.; SHINOZAKI, K. Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell, 2001, roč. 13. č. 1, s. 61-72. ISS 1040-4651. SEO, J. S.; LEE, K. W.; RHEE, J. S.; HWANG, D. S.; LEE, Y. M.; PARK, H. G.; AHN, I. Y.; LEE, J. S. Environmental stressors (salinity, heavy metals, H2O2) modulate expression of glutathione reductase (GR) gene from the intertidal copepod Tigriopus japonicus. Aquatic Toxicology, 2006, roč. 80. č. 3, s. 281289. ISS 0166-445X. SEREGIN, I. V.; KOZHEVNIKOVA, A. D. Histochemical Methods for Detection of Heavy Metals and Strontium in the Tissues of Higher Plants. Russian Journal of Plant Physiology, 2011, roč. 58. č. 4, s. 721-727. ISS 1021-4437. SETH, C. S.; REMANS, T.; KEUNEN, E.; JOZEFCZAK, M.; GIELEN, H.; OPDENAKKER, K.; WEYENS, N.; VANGRONSVELD, J.; CUYPERS, A. Phytoextraction of toxic metals: a central role for glutathione. Plant Cell and Environment, 2012, roč. 35. č. 2, s. 334-346. ISS 0140-7791. SHAH, F. U. R.; AHMAD, N.; MASOOD, K. R.; PERALTA-VIDEA, J. R.; AHMAD, F. U. D. Heavy Metal Toxicity in Plants. In: ASHRAF, M.; OZTURK M.; AHMAD M. S. A., eds. Plant Adaptation and Phytoremediation, 2010. SHAH, K.; NONGKYNRIH, J. M. Metal hyperaccumulation and bioremediation. Biologia Plantarum, 2007, roč. 51. č. 4, s. 618-634. ISS 0006-3134. SHEN, G. M.; ZHU, C.; SHANGGUAN, L. N.; DU, Q. Z. The Cd-tolerant rice mutant cadH-5 is a high Cd accumulator and shows enhanced antioxidant activity. Journal of Plant Nutrition and Soil Science, 2012, roč. 175. č. 2, s. 309-318. ISS 1436-8730.

191

SHESTIVSKA, V.; ADAM, V.; PRASEK, J.; MACEK, T.; MACKOVA, M.; HAVEL, L.; DIOPAN, V.; ZEHNALEK, J.; HUBALEK, J.; KIZEK, R. Investigation of the Antioxidant Properties of Metallothionein in Transgenic Tobacco Plants using Voltammetry at a Carbon Paste Electrode. International Journal of Electrochemical Science, 2011, roč. 6. č. 7, s. 2869-2883. ISS 1452-3981. SHI, W. Y.; SHAO, H. B.; LI, H.; SHAO, M. A.; DU, S. Progress in the remediation of hazardous heavy metal-polluted soils by natural zeolite. Journal of Hazardous Materials, 2009, roč. 170. č. 1, s. 1-6. ISS 0304-3894. SINGH, K. B.; FOLEY, R. C.; ONATE-SANCHEZ, L. Transcription factors in plant defense and stress responses. Current Opinion in Plant Biology, 2002, roč. 5. č. 5, s. 430-436. ISS 1369-5266. SMITAL, T.; SAUERBORN, R.; ZAJA, R.; LUCKENBACH, T.; HAMDOUN, A. M.; EPEL, D. Multidrug resistance-associated proteins (MRPs) as an integral part of multixenobiotic resistance (MXR) in aquatic organisms. Marine Environmental Research, 2006, roč. 62. č., s. S46-S47. ISS 0141-1136. SOLANKI, R.; DHANKHAR, R. Biochemical changes and adaptive strategies of plants under heavy metal stress. Biologia, 2011, roč. 66. č. 2, s. 195-204. ISS 00063088. SON, G. H.; WAN, J. R.; KIM, H. J.; NGUYEN, X. C.; CHUNG, W. S.; HONG, J. C.; STACEY, G. Ethylene-Responsive Element-Binding Factor 5, ERF5, Is Involved in Chitin-Induced Innate Immunity Response. Molecular PlantMicrobe Interactions, 2012, roč. 25. č. 1, s. 48-60. ISS 0894-0282. SONG, W. Y.; MARTINOIA, E.; LEE, J.; KIM, D.; KIM, D. Y.; VOGT, E.; SHIM, D.; CHOI, K. S.; HWANG, I.; LEE, Y. A novel family of cys-rich membrane proteins mediates cadmium resistance in Arabidopsis. Plant Physiology, 2004, roč. 135. č. 2, s. 1027-1039. ISS 0032-0889. STIBOROVA, M. CD-2+ IONS AFFECT THE QUATERNARY STRUCTURE OF RIBULOSE-1,5-BISPHOSPHATE CARBOXYLASE FROM BARLEY LEAVES. Biochemie Und Physiologie Der Pflanzen, 1988, roč. 183. č. 5, s. 371-378. ISS 0015-3796. STIBOROVA, M.; DOUBRAVOVA, M.; BREZINOVA, A.; FRIEDRICH, A. EFFECT OF HEAVY-METAL IONS ON GROWTH AND BIOCHEMICAL CHARACTERISTICS OF PHOTOSYNTHESIS OF BARLEY (HORDEUMVULGARE-L). Photosynthetica, 1986, roč. 20. č. 4, s. 418-425. ISS 0300-3604. STIBOROVA, M.; DOUBRAVOVA, M.; LEBLOVA, S. A COMPARATIVE-STUDY OF THE EFFECT OF HEAVY-METAL IONS ON RIBULOSE-1,5BISPHOSPHATE CARBOXYLASE AND PHOSPHOENOLPYRUVATE CARBOXYLASE. Biochemie Und Physiologie Der Pflanzen, 1986, roč. 181. č. 6, s. 373-379. ISS 0015-3796.

192

SUBRAMANIAM, R.; DESVEAUX, D.; SPICKLER, C.; MICHNICK, S. W.; BRISSON, N. Direct visualization of protein interactions in plant cells. Nature Biotechnology, 2001, roč. 19. č. 8, s. 769-772. ISS 1087-0156. SUNKAR, R. MicroRNAs with macro-effects on plant stress responses. Seminars in Cell & Developmental Biology, 2010, roč. 21. č. 8, s. 805-811. ISS 1084-9521. SUPALKOVA, V.; HUSKA, D.; DIOPAN, V.; HANUSTIAK, P.; ZITKA, O.; STEJSKAL, K.; BALOUN, J.; PIKULA, J.; HAVEL, L.; ZEHNALEK, J.; ADAM, V.; TRNKOVA, L.; BEKLOVA, M.; KIZEK, R. Electroanalysis of plant thiols. Sensors, 2007, roč. 7. č. 6, s. 932-959. ISS 1424-8220. clanek IF 1.573 SUWABE, K.; YANO, K. Omics databases in plant science: key to systems biology. Plant Biotechnology, 2008, roč. 25. č. 5, s. 413-422. ISS 1342-4580. SUZUKI, N.; KOUSSEVITZKY, S.; MITTLER, R.; MILLER, G. ROS and redox signalling in the response of plants to abiotic stress. Plant Cell and Environment, 2012, roč. 35. č. 2, s. 259-270. ISS 0140-7791. SZALAI, G.; KELLOS, T.; GALIBA, G.; KOCSY, G. Glutathione as an Antioxidant and Regulatory Molecule in Plants Under Abiotic Stress Conditions. Journal of Plant Growth Regulation, 2009, roč. 28. č. 1, s. 66-80. ISS 0721-7595. TEMPLIN, M. F.; STOLL, D.; SCHRENK, M.; TRAUB, P. C.; VOHRINGER, C. F.; JOOS, T. O. Protein microarray technology. Trends in Biotechnology, 2002, roč. 20. č. 4, s. 160-166. ISS 0167-7799. TESTER, M.; LEIGH, R. A. Partitioning of nutrient transport processes in roots (vol 52, pg 445, 2001). Journal of Experimental Botany, 2001, roč. 52. č. 356, s. 356356. ISS 0022-0957. THANNICKAL, V. J.; FANBURG, B. L. Reactive oxygen species in cell signaling. American Journal of Physiology-Lung Cellular and Molecular Physiology, 2000, roč. 279. č. 6, s. L1005-L1028. ISS 1040-0605. TODERICH, K. N.; SHUYSKAYA, E. V.; KHUJANAZAROV, T. M.; ISMAIL, S.; KAWABATA, Y. The Structural and Functional Characteristics of Asiatic Desert Halophytes for Phytostabilization of Polluted Sites. In: ASHRAF, M.; OZTURK M.; AHMAD M. S. A., eds. Plant Adaptation and Phytoremediation. Dordrecht: Springer, 2010. TUOMAINEN, M. H.; NUNAN, N.; LEHESRANTA, S. J.; TERVAHAUTA, A. I.; HASSINEN, V. H.; SCHAT, H.; KOISTINEN, K. M.; AURIOLA, S.; MCNICOL, J.; KARENLAMPI, S. O. Multivariate analysis of protein profiles of metal hyperaccumulator Thlaspi caerulescens accessions. Proteomics, 2006, roč. 6. č. 12, s. 3696-3706. ISS 1615-9853.

193

UTTAMCHANDANI, M.; NEO, J. L.; ONG, B. N. Z.; MOOCHHALA, S. Applications of microarrays in pathogen detection and biodefence. Trends in Biotechnology, 2009, roč. 27. č. 1, s. 53-61. ISS 0167-7799. VACEK, J.; HAVRAN, L.; FOJTA, M. Electrochemical Analysis of DNA Damage, Hybridization and Interactions. Chemicke Listy, 2011, roč. 105. č. 1, s. 15-26. ISS 0009-2770. VAMERALI, T.; BANDIERA, M.; MOSCA, G. Field crops for phytoremediation of metal-contaminated land. A review. Environmental Chemistry Letters, 2010, roč. 8. č. 1, s. 1-17. ISS 1610-3653. VANKOVA, R. Abscisic Acid Signaling in Plants. In: AHMAD, P.; PRASAD M. N. V., eds. Abiotic Stress Responses in Plants: Metabolism, Productivity and Sustainability. New York: Springer, 2012. VIDAL, E. A.; ARAUS, V.; LU, C.; PARRY, G.; GREEN, P. J.; CORUZZI, G. M.; GUTIERREZ, R. A. Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America, 2010, roč. 107. č. 9, s. 4477-4482. ISS 0027-8424. VIJ, S.; TYAGI, A. K. Emerging trends in the functional genomics of the abiotic stress response in crop plants. Plant Biotechnology Journal, 2007, roč. 5. č. 3, s. 361380. ISS 1467-7644. VILLIERS, F.; DUCRUIX, C.; HUGOUVIEUX, V.; JARNO, N.; EZAN, E.; GARIN, J.; JUNOT, C.; BOURGUIGNON, J. Investigating the plant response to cadmium exposure by proteomic and metabolomic approaches. Proteomics, 2011, roč. 11. č. 9, s. 1650-1663. ISS 1615-9853. WANG, J. From DNA biosensors to gene chips. Nucleic Acids Research, 2000, roč. 28. č. 16, s. 3011-3016. ISS 0305-1048. WANG, J. Electrochemical nucleic acid biosensors. Analytica Chimica Acta, 2002, roč. 469. č. 1, s. 63-71. ISS 0003-2670. WANG, J. Nanoparticle-based electrochemical DNA detection. Analytica Chimica Acta, 2003, roč. 500. č. 1-2, s. 247-257. ISS 0003-2670. WANG, J.; KAWDE, A. N. Magnetic-field stimulated DNA oxidation. Electrochemistry Communications, 2002, roč. 4. č. 4, s. 349-352. ISS 13882481. WANG, J.; LIU, G. D.; MERKOCI, A. Electrochemical coding technology for simultaneous detection of multiple DNA targets. Journal of the American Chemical Society, 2003, roč. 125. č. 11, s. 3214-3215. ISS 0002-7863.

194

WANG, J.; LIU, G. D.; MERKOCI, A. Particle-based detection of DNA hybridization using electrochemical stripping measurements of an iron tracer. Analytica Chimica Acta, 2003, roč. 482. č. 2, s. 149-155. ISS 0003-2670. WANG, J.; POLSKY, R.; MERKOCI, A.; TURNER, K. L. "Electroactive beads" for ultrasensitive DNA detection. Langmuir, 2003, roč. 19. č. 4, s. 989-991. ISS 0743-7463. WANG, J.; POLSKY, R.; XU, D. K. Silver-enhanced colloidal gold electrochemical stripping detection of DNA hybridization. Langmuir, 2001, roč. 17. č. 19, s. 5739-5741. ISS 0743-7463. WANG, J.; RINCON, O.; POLSKY, R.; DOMINGUEZ, E. Electrochemical detection of DNA hybridization based on DNA-templated assembly of silver cluster. Electrochemistry Communications, 2003, roč. 5. č. 1, s. 83-86. ISS 1388-2481. WANG, J.; XU, D. K.; KAWDE, A. N.; POLSKY, R. Metal nanoparticle-based electrochemical stripping potentiometric detection of DNA hybridization. Analytical Chemistry, 2001, roč. 73. č. 22, s. 5576-5581. ISS 0003-2700. WANG, J. X.; FENG, X. B.; ANDERSON, C. W. N.; XING, Y.; SHANG, L. H. Remediation of mercury contaminated sites - A review. Journal of Hazardous Materials, 2012, roč. 221. č., s. 1-18. ISS 0304-3894. WASCHKE, A.; SIEH, D.; TAMASLOUKHT, M.; FISCHER, K.; MANN, P.; FRANKEN, P. Identification of heavy metal-induced genes encoding glutathione S-transferases in the arbuscular mycorrhizal fungus Glomus intraradices. Mycorrhiza, 2006, roč. 17. č. 1, s. 1-10. ISS 0940-6360. WEBER, M.; TRAMPCZYNSKA, A.; CLEMENS, S. Comparative transcriptome analysis of toxic metal responses in Arabidopsis thaliana and the Cd2+hypertolerant facultative metallophyte Arabidopsis halleri. Plant Cell and Environment, 2006, roč. 29. č. 5, s. 950-963. ISS 0140-7791. WEI, S. H.; ZHOU, Q. X.; WANG, X. Identification of weed plants excluding the uptake of heavy metals. Environment International, 2005, roč. 31. č. 6, s. 829834. ISS 0160-4120. WOOD, T. K. Molecular approaches in bioremediation. Current Opinion in Biotechnology, 2008, roč. 19. č. 6, s. 572-578. ISS 0958-1669. WU, F. L.; LIN, D. Y.; SU, D. C. The Effect of Planting Oilseed Rape and Compost Application on Heavy Metal Forms in Soil and Cd and Pb Uptake in Rice. Agricultural Sciences in China, 2011, roč. 10. č. 2, s. 267-274. ISS 1671-2927. XIANG, C. B.; OLIVER, D. J. Glutathione metabolic genes coordinately respond to heavy metals and jasmonic acid in Arabidopsis. Plant Cell, 1998, roč. 10. č. 9, s. 1539-1550. ISS 1040-4651.

195

XIE, Z. X.; ALLEN, E.; FAHLGREN, N.; CALAMAR, A.; GIVAN, S. A.; CARRINGTON, J. C. Expression of Arabidopsis MIRNA genes. Plant Physiology, 2005, roč. 138. č. 4, s. 2145-2154. ISS 0032-0889. YADAV, R.; ARORA, P.; KUMAR, S.; CHAUDHURY, A. Perspectives for genetic engineering of poplars for enhanced phytoremediation abilities. Ecotoxicology, 2010, roč. 19. č. 8, s. 1574-1588. ISS 0963-9292. YADAV, S. K. Heavy metals toxicity in plants: An overview on the role of glutathione and phytochelatins in heavy metal stress tolerance of plants. South African Journal of Botany, 2010, roč. 76. č. 2, s. 167-179. ISS 0254-6299. YAMAGUCHI, H.; FUKUOKA, H.; ARAO, T.; OHYAMA, A.; NUNOME, T.; MIYATAKE, K.; NEGORO, S. Gene expression analysis in cadmium-stressed roots of a low cadmium-accumulating solanaceous plant, Solanum torvum. Journal of Experimental Botany, 2010, roč. 61. č. 2, s. 423-437. ISS 0022-0957. YANG, T. W.; XUE, L. G.; AN, L. Z. Functional diversity of miRNA in plants. Plant Science, 2007, roč. 172. č. 3, s. 423-432. ISS 0168-9452. YANG, X. E.; JIN, X. F.; FENG, Y.; ISLAM, E. Molecular mechanisms and genetic basis of heavy metal tolerance/hyperaccumulation in plants. Journal of Integrative Plant Biology, 2005, roč. 47. č. 9, s. 1025-1035. ISS 1672-9072. YANG, X. F.; GAO, M. M.; HU, H. D.; ZHANG, H. J. Electrochemical Detection of Honokiol and Magnolol in Traditional Chinese Medicines using Acetylene Black Nanoparticle-modified Electrode. Phytochemical Analysis, 2011, roč. 22. č. 4, s. 291-295. ISS 0958-0344. YU, D. Q.; CHEN, C. H.; CHEN, Z. X. Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene express ion. Plant Cell, 2001, roč. 13. č. 7, s. 1527-1539. ISS 1040-4651. ZAFFAGNINI, M.; BEDHOMME, M.; LEMAIRE, S. D.; TROST, P. The emerging roles of protein glutathionylation in chloroplasts. Plant Science, 2012, roč. 185. č., s. 86-96. ISS 0168-9452. ZHANG, C. Y.; YEH, H. C.; KUROKI, M. T.; WANG, T. H. Single-quantum-dotbased DNA nanosensor. Nature Materials, 2005, roč. 4. č. 11, s. 826-831. ISS 1476-1122. ZHANG, K. W.; GAN, S. S. An Abscisic Acid-AtNAP Transcription Factor-SAG113 Protein Phosphatase 2C Regulatory Chain for Controlling Dehydration in Senescing Arabidopsis Leaves. Plant Physiology, 2012, roč. 158. č. 2, s. 961969. ISS 0032-0889. ZHANG, M.; LIU, X. C.; YUAN, L. Y.; WU, K. Q.; DUAN, J.; WANG, X. L.; YANG, L. X. Transcriptional profiling in cadmium-treated rice seedling roots using

196

suppressive subtractive hybridization. Plant Physiology and Biochemistry, 2012, roč. 50. č., s. 79-86. ISS 0981-9428. ZHAO, Y.; HAO, C. L.; MA, W.; YONG, Q. Q.; YAN, W. J.; KUANG, H.; WANG, L. B.; XU, C. L. Magnetic Bead-Based Multiplex DNA Sequence Detection of Genetically Modified Organisms Using Quantum Dot-Encoded Silicon Dioxide Nanoparticles. Journal of Physical Chemistry C, 2011, roč. 115. č. 41, s. 2013420140. ISS 1932-7447. ZHEN, Y.; QI, J. L.; WANG, S. S.; SU, J.; XU, G. H.; ZHANG, M. S.; MIAO, L.; PENG, X. X.; TIAN, D. C.; YANG, Y. H. Comparative proteome analysis of differentially expressed proteins induced by Al toxicity in soybean. Physiologia Plantarum, 2007, roč. 131. č. 4, s. 542-554. ISS 0031-9317. ZHOU, Z. S.; ZENG, H. Q.; LIU, Z. P.; YANG, Z. M. Genome-wide identification of Medicago truncatula microRNAs and their targets reveals their differential regulation by heavy metal. Plant Cell and Environment, 2012, roč. 35. č. 1, s. 86-99. ISS 0140-7791. ZHU, C.; DING, Y. F.; LIU, H. L. MiR398 and plant stress responses. Physiologia Plantarum, 2011, roč. 143. č. 1, s. 1-9. ISS 0031-9317.

197

Seznam zkratek ABA kyselina abscisová ABRE promotorová oblast reagující na ABA (ABA-responsive element) ADP adenosindifosfát (Adenosine diphosphate) ATP adenosintrifosfát (Adenosine triphosphate)

CDK cyklin-dependentní kinázy Cys cystein DNA deoxyribonukleová kyselina DPV diferenční pulzní voltametrie EDTA kyselina ethylendiamintetraoctová (Ethylendiamintetraacetic acid)

Glu kyselina glutamová Gly glycin GSH redukovaný glutation GSSG oxidovaný glutation HMDE visící rtuťová kapková elektroda (Hanging mercury drop electrode) HMW vysokomolekulární komplex (High molecular complex)

HSP proteiny teplotního šoku (heat shock protein) MPs paramagnetické částice NPs nanočástice LEA proteiny hojné při pozdní embryogenezi (late-embryogenesis abundant) LMW nízkomolekulární komplex (Low molecular complex) MAPK mitogenem aktivovaná proteinkináza

mRNA mediátorová ribonukleová kyselina miRNA mikroRNA NADPH nikotinamidadenindinukleotidfosfát (Nicotinamide adenine dinucleotide phosphate) PCS fytochelatin syntetáza (Phytochelatine synthase) PCR polymerázová řetězová reakce

RISC umlčující komplex aktivovaný malými RNA (RNA-induced silencing complex) ROS reaktivní kyslíkové látky (reactive oxygen species) RSE raná somatická embrya SH sulfhydrylová skupina SnRK2 proteinkináza příbuzná SNF1 (SNF1-related proteinkinase) WRKY transkripční faktory s konzervovanou aminokyselinovou sekvencí

198