B. SIMPULAN DAN SARAN A. Simpulan 1.
Ekstrak tanaman obat Nan Fei Shu tidak memiliki aktivitas antifungi terhadap Candida albicans.
2. Penamaan ilmiah tanaman obat Nan Fei Shu yakni Vernonia amygdalina atau Gymnanthemum amygdalinum. B. Saran de perlu dilakukan dilaku kuka k n isolasi senyawa fitol dan 1. Ekstrak crud crude neophy yta tadienee ddengan engan kkromatografi roma ro mato t gr g affi cair seperti HPLC untuk neophytadiene men nguj ujii potensi pote po tensi senyawa tersebut terseb but u dalam dal alam m menghambat m menguji Candida al lbica cans ns. albicans. Kult Ku ltur u yang digunakan untuk peng nguj ujiaan aktivitas antifungi 2. Kultur pengujian dire reko k mendasikan berasal ber eras asal dari genuinee Am direkomendasikan American Type Culture Coll lec ecti tion o dan dan sselanjutnya elan el anju jutn tnya ya penggunaan pen engg ggunaa aan n kul Collection kultur maksimal berasal genuine American Culture Collection (ATCC) dari subkultur genui ine Am merican Type Cultu yang kelima. 3. Ekstraksi perlu dilakukan dari bahan simplisia segar menggunakan metode perkolasi dengan pelarut non polar seperti petroleum eter dan heksana terhadap Aspergillus niger, Aspergillus fumigatus, dan Aspergillus flavus.
47
DAFTAR PUSTAKA Abascal, K., Ganora, L., Yarnell, E. 2005. The Effect of Freeze drying and its Implications for Botanical Medicine: A review. Phytother. 19:665-660. Allen, L.V., Popovich, N.G., Ansel, H.C. 2011. Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems. Edisi Kesembilan. Wolters Kluwer and Lippincott Williams & Wilkins, Philadelphia. Halaman 23-25. Aly, R. 2001. Skin, Hair, and Nail Fungal Infections. Infectious Disease in Clinical Practice. 10(2): 117-122. Amani, J., Kazemi, 2011. A Simple and Rapid mi, R., Abbasi, A.R.,., Salmanian, Salmanian, A.H. 2011 Leaf Genomic Extraction Method Chain Reaction omic DNA Ext xtrraction Meth thod o for Polymerase Polyme Analysis. Iranian Jour Journal urnal off Biotechnology. Biotechnologyy. 9(1): 69-71. 69-7 American Type Cult Culture Collection. 2014. FAQ: Bacterial Strains. lturee Co C llec ecti tion. 20 014 14. FA F Q: Subculture Sub ubcult http://www.atcc.org/Global/FAQs/7/3/Subculture%20bacterial%20strainsw.aatcc..or org/ g/Gl Global/FAQs/7/3/Subc bcul ultu ture re%2 %20b 129.aspx. Di Diakses Diak kse sess ta tanggal 20 Agustus 2015. Anand, S. dan Pr Prasad, P asad as d, R. 1991. Growth and Respirationi Resspi pira rati tio o Characteristics of Candida albicans. Halaman biica cans. Springer Berlin Heidelberg. Ha alama man n 47. Arikan, S. 2007. susceptibility testing methods. 7. Currentt sstatus tatu ta tuss of aantifungal ntif nt ifun unga gall suscepti tibi b Medical My Mycology. yco colo logy g . 45:569-587. Arundhina, E. 2014 2014. Aktivitas Etanol Daun Alamanda (Allamanda 14.. Ak Akti tivi vita tass Ekstrak Ekst Ek stra rak k Et Etan anol ol D aun au n A cathatica) sebagaii A Antijamur dan Pityosporum ntijamur terhadap t rh te hadap Candida Candid dida albicans albic ovale secara Teknobiologi. ra In Vitro. Journall Tekn nobiologi. Halaman 1-15. Azmat, M.A., Khan, Khan, A.S., dan Khan, han, I.A., Cheema, H.M.N., H.M .M.N., Rajwana, I.A., K A.A. 2012. Extraction of DNA S Suitable from Mature uitable for PCR Applications App Leaves of Mangifera indica L. Journal of Zhejiang Univeristy. 13(4):239243. Badan Pusat Statistik. 2002. Dikutip dari: Supardi, S., Nurhadiyanto, F., Eng, S.W. Penggunaan Obat Tradisional Buatan Pabrik dalam Pengobatan Sendiri di Indonesia. Jurnal Bahan Alam Indonesia. 2(4):136-141. Benaducci, S.L., Almedia, A.M.F., Silva, D.H.S., Bolzani, V.S., dan MendesGiannini, M.J.S. 2007. Comparative Study of Disk Diffusion and Microdilution Methods for Evalution of Antifungal Activity of Natural Compounds against Medical Yeasts Candida spp and Cryptococcus sp. Rev.Cienc.Farm.Basica Apl. 28(1):25-34.
48
49
Bernhoft, A. 2010. A Brief Review on Bioactive Compounds in Plants. Dalam:Bioactive Compounds in Plants – Benefits and Risks for Man and Animals. The Norwegian Academy of Science and Letters, Norwegia. Halaman 7 Bucar, F. Wube, A., dan Schmid, M. 2013. Natural Product Isolation - How to Get from Biological Material to Pure Compounds. Nat.Prod.Rep. 30: 525-545. Cambrex. 2014. The Sourcebook: A Handbook for Gel Electrophoresis. Cambrex Bio Science Rockland, Inc., Maine. Halaman 8-42. Campbell, N.A., Reece, J.B. dan Mitchell, L.G. 2002. Biologi. Jilid ke-1. Erlangga, Jakarta. Halaman 55. Cannon, R.D., Lamping, E., Holmes, Niimi, ., H olmes, A.R., Nii iimi m , K., Tanabe, Tanab K., Niimi, M., dan Monk, B.C. C. 2007. Candida Canddid da albcians albc al bcia ians ns drug drug resistance resis istance – Another Way to Cope With Stress. s. Microbiology. Miccrobio iology gy. 153:3211-3217. 153: 15 3:32 3211 11-3 321 2 7.. Chen, S. Slavin, Australia Study: Active n, M., M.,, Nguyen, Ngu guyen, Q. 2006. Aust tra rali liaa Candidemia Cand Ca n i Surveillance Dis. cee for or Candidemia. Can andidemia. Emerg Infect D is. 12(10):1508-1516. is 12(1 12 ( 0) 0 Chen, S., Yao, H., H Han, an, J., Liu, C., Song, J., Shi, L., Zhu, Zh hu, Y., Y.,, Ma, X., Gao, T., Pang, X., Luo, K., Li, Leon, C. 2010. Validation of ., L i, Y., Y., Li, X., Jia, X., Lin, Y., dan L eon, eo n, C the ITS2 Region Barcode Identifying Medicinal Plant Reg egion as a Novel Nov ovel el DNA DNA B arco ar code de for Ide ent nti Species. Plos los os One. One. 5(1):e8613 Chen, Y., Zeng, Tian, Ban, X., B., g, H., Ti Tian an, JJ., ., Ba an, n X ., Ma, B ., Wang, Wang, Y. 2013. Antifungal mechanism from m of essential oil fro om Anethum An nethum graveolens seeds against Candida albicans. Journal of Medical M Microbiology. icroobiology. 62:1175-1183. 62:1175-1 Cold Spring Harbor extract peptone-dextrose (YEPD). b Protocol. P l 2010. 2010 Yeast Y Protocols. February 2010: doi:10.1101/pdb.rec12161. diakses tanggal 15 November 2014. Cowan, M.M. 1999. Plant products as antimicrobial agents. Clin.Microbiol.Rev. 12:564-582. dePapua, L.S., Bunyaprophatsara, N., dan Lemmens, R.H.M.J. 1999. Plant Resources of South-East Asia No 12 (1) Dalam:Medicinal and poisonous plant 1. Backhuys Publishers, Leiden. Halaman 32, 493-497. Deuschle, R.A.N., Camargo, T., Francescato, L.N., Alves, S.H., dan Heinzmann, B.M. 2006. Antimicrobial Activity of Senecio desiderabilis Vellozo (Asteraceae). Acta Farm. Bonaerense. 25(3):356-359.
50
Devkatte, A.N., Zore, G.B., dan Karuppayil, S.M. 2005. Potential of Plant Oils as Inhibitor of Candida albicans Growth. FEMS Yeast Research. 5: 867-873. Dewoto, H.R. 2007. Pengembangan Obat Tradisional Indonesia Menjadi Fitofarmaka. Maj Kedokt Indon. 57(7):205-211. Direktorat Jenderal Pengembangan Ekspor Nasional. 2014. Warta Ekspor. Ditjen PEN/MJL/005/9/2014. Kementrian Perdagangan Republik Indonesia. Jakarta. Halaman 4. Duarte, M. R. Dan Silva, A.G. 2013. Anatomical Characters of the Medicinal Leaf and Stem of Gymnanthemum amygdalinum (Delile) Sch.Bip. ex Walp. (Asteraceae). Brazilian Journal of Pharmaceutical Sciences. 49(4): 719-727. macopoeia. 2005. 14 1433 33 He Herb rbal a Drugs. Dalam: European Pharmacopoeia. Herbal Dalam:General Monographs. ma. Volume 11.. Council of Euro ope pe. Halaman 572. Edisi kelima. Europe. mingty yas, E. E L , Wi L. Widy dyas asar ari, i, S ., ddan a R an ahay Fatchiah., Arumingtyas, E.L., Widyasari, S., Rahayu., S. 2011. Biologi Molekuler – P Prinsip Analisis.. Penerbit rinssip Dasar Das asar Analisis Peneerb rbitt Erlangga. Erl rlan ngg g a Jakarta. Halaman 15. Franca, L.T.C., C Carrilho, arrril ilho ho, E., dan Kist, T.B.L. 2002. A review rev eview w of DNA Sequencing Techniques. Quarterly s. Qu Quar rterly Reviews of Biophysics. 335(2): 5(2 (2): ): 169-200. 1 Gaylord Chemical Company. 2007. Dimethyl Sulfoxide (DMSO) Health and Safety al C om mpany ny. 20 2007 07. Di D meeth thyl yl S ulfo ul foxide de (DM DM Information. Buletin 3. n. B uletin GGC. No. 106 10 (Oktober 2007). 2007) 7). Halaman H GeneMark. 2013. Protocol Gel Elution Kit DP 3. Pr Prot otoc ocol ol G el E lu uti tion n K it D P 03-300. 03-3 03 -300. GMbiolab Co., Ltd. http://www.genemarkbio.com/3.english/images/Datasheet/(W)DP03-Gel_ w.genemarkbio.com m/3 /3.eng nglish/images/Datash Elution_Kit-20140502.pdf it-20140502.pdf . Akses Aksess tanggal 18 November Novemb 2014. Gershenzon, J., McConkey McConkey, M M.E., Croteau, R R.B. E dan Croteau B 2000. Regulation of Monoterpene Accumulation in Leaves of Peppermint. Plant Physiology. 122:205-213. Griffiths, A.J.F., Miller, J.H., Suzuki, D.T. 2000. An Introduction to Genetic Analysis. Edisi ketujuh. W.H. Freeman and Company, New York. Halaman 337. Grob, K. 2000. Survey of Injection Technigques. Dalam:Split and Splitless Injection for Quantitative Gas Chromatography. Edisi keempat. Wiley-VCH Verlag GmbH, Weinheim. Halaman VII.
51
Hafidh, R.R., Abdulamir, A.S., Vern, L.S., Abu Bakar, F., Abas, F., Jahanshiri, F., dan Sekawi, Z. 2011. Inhibition of Growth of Highly Resistant Bacterial and Fungal Pathogens by a Natural Product. The Open Microbiology Journal. 5:96-106. Hanelt, P. 2001. Mansfeld’s Encyclopedia of Agricultural and Horticultural Crops. Springer-Verlag, Berlin, Halaman 2047. Hajslova, J. dan Cajka, T. 2007. Gas Chromatography-Mass Spectrometry. Dalam:Food Toxicants Analysis. Elsevier B.V., Chennai. Halaman 419. Harbourne, J.B. 1987. Metode Fitokimia: Penuntun Cara Modern Menganalisis Tumbuhan. Penerbit Halaman 67. n. Edisi kedua. Pen ner erbi bitt IT ITB, B Bandung. Halam Harley, J. P. & L. M. Prescott. Laboratory Pres escott. 2002. 2002 02.. La Labo bora ratory Exercises Exe x rcises iin Microbiology. Edisi ke lima. McGraw McGraw-Hill. Halaman w-Hiill l . New New York. Yoork rk. Ha H lama la m n 368. 8. Hart, H. 2007. Kim Kimia Organik: Jakarta. Halaman imiaa O rganik: suatu kuliah singkat. rg singk gkat at.. Erlangga, Erlaang n 399. Hazen, K.C. 2013. 3. Influence I flluence of DMSO on antifungal aactivity In ctiivi vitty during susceptibility testing in vit vitro. Diagnostic itrro. D iaggno nost stic ic Microbiologu Mic icrobi biol olog ogu u and an Infectious In nfe fectio iou Disease. 75: 60-63 HiMedia. 2011. Te Technical Dextrose Agar. HiMedia Tech chnical Data M063: M06 0 3: Sabouraud d D e ex Laboratories, Mumbai. Halaman es, Mu Mumb mbai ai. Ha Hala lama man n 1. Hollingsworth, P.M., Forrest, L.L., Spouge, CBOL Plant Working Spo ouge, J.L. 2009. C Group: A DNA Barcode forr Lan Land Proceedings of the National and Plants. Proceed Academy of Sciences. 106:12794 106:12794-12797. 94--12797. Hornby, A.S. 2010. Oxford Advanced learner’’s Dictionary of Current English. Oxford University Press. Halaman 271. Houghton, P.J. dan Raman, A. 1998. Laboratory Handbook for the Fractionation of Natural Extracts. Chapman and Hall, London. Halaman 22. Inamdar, P.K. dan Chatterjee, S. 2000. Terpenoids: Liquid Chromatography. Academic Press, India. Halaman 4354-4362. Innis, M.A. dan Gelfand, D.H. 1990. Optimization of PCRs. Dalam:PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego. Halaman 3-12.
52
International Centre for Science and High Technology-United Nations Industrial Development Organizations. 2008. Extraction technologies: for Medicinal and Aromatic Plants. United Nations Industrial Development Organization and the International Centre for Science and High Technology, Trieste. Izquierdo, A.A., Lopez, G.A., Arendrup, M.C., Florl, L.C., Hope, W.W., Perlin, D.S., Tudela, J.L.R.., dan Estrella, M.C. 2012. Comparison of Dimethyl Sulfoxide and Water as Solvents for Echinocandin Susceptibility Testing by the EUCAST Methodology. Journal of Clinical Microbiology. 50(7):25092512. Kanafani, Z.A. dan Perfect, J.R. 2008. Resistance to Antifungal Agents: Mechanisms and Clinical Impact. Clinical Infectious Diseases. 46:120-128. Khan, M.S.A., Ahmad, I., dan S.S. Aldehyde and dan Cameotra, S .S. 2013. Phenyl P Propanoidss Exert Multiple Cell Membrane and Cell Multipl p e Sites Siite tess of Action Act c ion Towards Towa To w rds Ce Wall Targeting Ergosterol Candida albicans. AMB Express. 3:54 eting E rgosstero roll in Cand did ida al albi b ca cans. AM A BE Kim, D., Shin, W.S., Koh, C.M. 2002. Rapid W.S S., Lee, Lee ee, K.H., K. Kim, K., Park, k JJ.Y. .Y.. da .Y ddan nK differentiation Candida species using its tio ion of Ca Candida albicans from other oth ther er Cand n unique germ rm m tube tub fformation ormation at 39oC. Yeast. 19:957-962. 19:9 :957 57-9 -96 62 Kim, H.G., Sterling, C.K., evidence for ing, C. in .K., Vroom, P.S., Jansen, R.K. 1998. 199 98. Molecular M an African Hawaiian endemic (Asteraceae). n oorigin rigiin off tthe he H awaiiaan en aw ende demi micc Herperomannia H rper He ero o Proc. Natl.. Acad. 95:15440-15445 Acad Ac a . Sci. USA. 95:1 154 5 40-15445 Konig, G.M. dan Wright, A.D. 1997. Sesquiterpene Content n Wr Wrig ight ht, A. A.D D. 199 997. Ses esquit iter erpe pene ne C onten of the Antibacterial Dichloromethane Marine Laurencia obtusa.Planta methane Extract of tthe he M arine Red Alga La Medica. 63:168-187 3:168-187 er, H.J., Kruger, A., Ryd ydberg, A., Abbad, A., Bjork, L., dan Martin, Kool, A., de Boer, Rydberg, G. 2012. Molecular Identification of Commercialized Medicinal Plants in Southern Morocco. Plos One. 7(6): e39459. Kostiala, A.A.I. dan Kostiala, I. 1984. Broth dilution and Disc Diffusion Methods in the Susceptiblity Testing of Pathogenic Candida albicans against four antimycotics. Mycopathologia. 87:121-127 Kunzhang,W. 2013. ⫢㐃㸸ᡥ᱈ⴥᩬ㬀⳥⤂ Journal of Taiwan Medicinal Plants. 3(1):17-18. Larone, D.H. 1995. Medically Important Fungi: a Guid to Identification. American Society for Microbiology, Washington. Halaman 219. Luo, X., Jiang, Y., Fronczek, F.R., Lin, C., Izecbigie, E.B., dan Lee, K.S. 2011. Isolation and Structure determination of a Sesquiterpene Lactone
53
(Vernodalinol) from Vernonia amygdalina extracts. Pharm Biol. 49(5): 464470. Madigan, M.T., Martinko, J.M., dan Parker, J. 2009. Brock’s Biology of Microorganisms. Edisi kesebelas. Pearson Education International, New Jersey. Halaman 145 dan 705 Megha, S.V. dan Minal, R.C. 2013. Novel Techniques for Isolation and Extraction of Phyto-Constituents from Herbal Plants. American Journal of Phytimedicine and clinical Therapeutics. 1(3):338-350. Men, A.E., Wilson, P., Siemering, K., dan Forrest, S. 2008. Sanger DNA Sewuencing. Dalam:Next-Generation Wiley-VCH ng. Dalam:Next-G Gen ener erat atio ion Genome Sequencing. Sequ Verlag GmbH mbH and Co. Kg KgaA, DOI: 10.1002/9783527625130.ch1. 10.10 1002/97835276 Mohandas, V. Dan Bal Ballal, Distribution alllal, M. 20 2011. Di Distri ibu buti tion n of Candida C ndid Species in Different Ca Clinical Samples Biofilm Proteinase and ampl ples and and Their The heir Virulence:: Bi Biof ofil ilm m Formation, Form Fo Phospholipase Production: pas ase Pr Prod oduuction: A Study on Hospitalized Hos o pi pita talizeed Patients in Southern India. Journal Global rnnal of G lobal Infectious Disease. 3(1):4-8 3(1) 3( 1):4 :4-8 Molero, G., Diez-Orejaz, z-O -Orejaaz, R., Navarro-Garcia, F., Monteoliva, Mon nteol oliv iv L., Pla, J., SanchezPerez, M., dan Nombela, albicans: Dimorphism, dan a N ombela,, C. 1998. Candida albic can ans:: Genetics, G and Pathogenicity. International Microbiol. 1:95-106. gen enic i ity. Int ternattio iona nal Mi Micr obi bioll. 1:95-10 06. Moreira, P.A., dan Oliveira, D.A. 2011. n O liveir li i a, D .A. 20 .A 2011 11. Le Leaf af age aaffects ffeects the quality of DNA ff extracted from Di Dimorphandra mollis (Fabaceae), tropical tree species from Dimo morp rph handra mol llis (Fab bac acea eae) e), a trop the Cerrado Genetics o region of Brazil. Genet tics and Molecular Research. 10(1): 353358. Morello, J.A., Granato, P.A., Mizer, H.E. 2003. Laboratory Manual and Workbook in Microbiology: Applications to Patient Care. Edisi ketujuh. McGraw-Hill Co, NY. Halaman 95 Murayama, S.Y., Negishi, Y., Umeyama, T., Kaneko, A. Oura, T., Niimi, M., Ubukata, K., dan Kajiwara, S. 2006. Construction and Functional Analysis of Fatty Acid Desaturase Gene Disruptants in Candida albicans. Microbiology. 152:1551-1558. Natur Indonesia. 2012. Daun Afrika Selatan. http://naturindonesia.com/index php/diabetes-militus/daun-afrika-selatan. Diakses tanggal 16 September 2015.
54
Nester, E.w., Denise, G.A., dan Evans, R. 2004. Microbiology a Human Perspective. McGrawHill co. New York. Halaman 817. Obistioiu, D., Cristina, R.T., Schmerold, I., Chizzola, R., Stolze, K., Nichita, I., Chiurciu, V. 2014. Chemical Characterization by GC-MS and in vitro Activity Candida albicans of volatile fractions prepared from Artemisia drcunculus, Artemisia abrotanum, Artemisia absinthium, and Artemisia vulgaris. Chemistry Central Journal. 8:6 Palozza, P. dan Krinsky, N.I. beta-Carotene and alpha-Tocopherol are Synergistic Antioxidants. Arch Biochem Biophys. 297(1):184-187. Pandey, A. dan Tripathi, S. 2014. Concept of Standardization, Extraction, and Pre Phytochemical Strategies mical Screening g St Strate tegi gies e for Herbal Drug. Journal of Pharmacognosy Phytochemistry. gnosy and Ph Phy ytochemistry. 2(5):115-119. 2(5) 5):1 : 15-119. Pasteur, A.R., Ullmann, of Candida llmannn, Y., Y., dan daan Berdicevsky, B rd Be rdic icev evsk sky, y, I. I. 2011. 2011 1. The Pathogenesis Pa Infections in a Human Hum Hu man n Skin Skiin Model: Sk Mod odel e : Scanning Scan Sc a ni ning n Electron Microscope Observations. Dermatology. onss. ISRN IS SRN D ermatology. doi:10.5402/2011/150642 doi:10.54 5402 02/2 /201 011/ 11 Paulsen, B.S. 2010. Medicine. Dalam: 0100. Highlights Higghlights Through the Historyy of Hi of Plant Pll Bioactive Co Compounds Compo ounds In Plants-Benefits And Risks Riskss For F Man And Animals. The Norwegian Norwegia. Halaman 23. egiaan Academy eg Academy of Science and Letters, Letterss, N orw rw Pfaller, M.A., Moet, S.A., R.N., M. 2011. Moe oet, t, H.J., Messer, S .A., Jones, R.N. N., Castanheira, C Geographicc V Variations Species Distribution Echinocandin and Azole aria ar iati tion onss in S peci pe cies es D istr is trib ibut utio ion n and and E c Antifungall Res Resistance sis ista tanc ncee Rates Rattes Among Ra Amon Am ong g Candida Cand ndid idaa Bloodstream Bloo Bl ood dstre Infection Isolates: Report from Antimicrobial m the SENTRY Ant ntiimiccro r bial Surveillance Program (2008-2009). J Clin Microbiol. 49(1):396-399. robiol. 49(1):396-39 99. Philips. 2013. Philips Spectrometry. hilips Inocation Service: Gas Chromatography-Mass Chromatograph http://www.innovationservices.philips.com/sites/default/files/materialsanaly sis-gcms.pdf. akses tanggal 20 September 2014. Pittsburgh Plate Glass. 2003. Methylene Chloride. www.ppgcloralkali.com. diakses tanggal 13 Juli 2015. Prescott, Harley, dan Klein. 2002. Antimicrobial Chemotherapy. Dalam:Microbiology. Edisi kelima. McGraw-Hill Co, NY. Halaman 809 dan 820. Rajput, S.B. dan Karuppayil, S.M. 2013. Small molecules inhibit growth, viabilitym and Ergosterol Biosynthesis in Candida albicans. SpringerPlus. 2:26
55
Randhawa, M.A. 2006. The Effect of Dimethyl Suloxide (DMSO) on the Growth of Dermatophytes. Jpn. J. Med. Mycol. 47:313-318. Rao, A., Zhang, Y., Muend, S., dan Rao, R. 2010. Mechanism of Antifungal Activity of Terpenoid Phenols Resembles Calcium Stress and Inhibition of the TOR Pathway. Antimicrobial Agents and Chemotherapy. 54(12): 50625069. Robinson, T. 1995. Kandungan organik Tumbuhan Tinggi. Edisi keenam. Penerbit ITB, Bandung. Halaman 134. Rodloff, A. Bauer, T., Ewig, S., Kujath, P., dan Muller, E. 2008. Susceptible, Intermediate, and Resistant – The Intensity of Antibiotic Action. Deutsches ( ) Arzteblatt International. 105(39):657-662 C.W W. 1995. Fisiolog gi Tumbuhan: Sel, Air Larutan dan Salisbury, F.B, dan Ross, C. C.W. Fisiologi Permukaan. Halaman 84. n. Jilid Satu. Sattu. Penerbit Sa Penerb rbit it ITB, ITB TB,, Bandung. B ndun Ba ng. g Halam Sanchez, E.C., Rod Rodriguez, Zarate, R.. 22008. Dichloromethane dri rigu uez ez, C. C., Ravelo, Ravelo, A.G., dan n Za ara rate te, R as a Solvent Lipid Classes and Fatty ntt forr Lipid Lip ipid id Extraction and Assessment Assesssme ment nt off L Acids from Journal Agricultural and Food m Samples Sam ampl ples of Different Natures. Jour rnaal of A Chemistry.. 56 56:4297-4303 56:4 :429 297-4303 Sarachek, A. dan Higgins, Ergosterol, nH igggins, N.P. 1972. Effects of Ergo ig gosster ero o Palmitic Acid, and Realted Simple from Ultraviolet mple mp l Lipids Lipid ds on the the Recovery Rec ecov over ery off Candida Candida albicans alb al b Irradiation.. Arch. 82:38-54. Arch Ar ch. Mikrbiol. 82:38 8-54. Sasidharan, S., Chen Chen, D., Sundram, n, Y. Y.,, Saravanan, Sara Sa rava vana nan, n, D ., S undr un dram am,, K.M., K.M. K. M., dan Latha, L.Y. 2011. Afr J Tradit Complement omplement Altern Med. Med. 8(1):1-10. 8(1):1-10. Sastrohamidjojo,, H. 2004. Kimia Minyak University Press, Minyyak Atsiri. Gadjah Mada Mi M Yogyakarta. a. Halaman 6 dan 31. Schmidt, J.C. dan Noland, D. 1997. Harvesting and Drying Herbs. Cooperative Extension Service: University of Illinois, Urbana-Champaign. Shokralla, S., Gibson, J.F., Nikbakht, H., Janzen, D.H., Hallwachs, W., dan Hajibabaei, M. 2014. Next generation DNA barcoding: using next-generation sequencing to enhance and accelerate DNA barcode capture from single specimens. Molecular Ecology Resources. 14:892-901. Shu, M., Ellepola, A.N.B., dan Samaranayake, L.P. 2001. Effects of Two Different Growth Media on the Postantifungal Effect Induced by Polyenes on Candida Species. Journal of Clinical Microbiology. 39(7):2732-2735.
56
Singleton, P. dan Sainsbury, D. 2006. Dictionary of Microbiology and Molecular Biology. Edisi ketiga revisi. John Wiley and Sons, West Sussex. Halaman 43. Sovova, H. dan Aleksovski, S.A. 2006. Mathematical model for hydrodistillation of essential oils. Flavour and Fragrance Journal. 21:881-889. Stamatopoulos, K., Chatzilazarou, A., Katsoyannos, E. 2014. Optimization of Multistage Extraction of Olive Leaves for Recovery of Phenolic Compounds at Moderated Temperatures and Short Extraction Times. Foods. 3:66-81. Suhartatik, N., Karyantina, M., Mustofa, A., Cahyanto, M.N., Raharjo, S., dan Rahayu, E.S. 2013. Stabilitas Ekstrak Antosianin Beras Ketan (Oryza sativa var. glutinosa)) Hitam Selama Proses Pemanasan dan Penyimpanan. Agritech. 33(4):384-390. 390. Supriyatna, Moelyono, Febriyanti, R.M. 2015. Prinsip Obat elyono,, M.W., M.W.,, Iskandar, Iskaand Is ndar ar, Y. Y.,, Fe Febriyan anti, R.M Herbal: Sebuah Pengantar Fitoterapi. Deepublish, Yogyakarta. ah P engant en nta ar untukk F i otter it erap api. Dee Halaman 37. The National Committee ommi mitteee for Clinical Laboratory Standards. Sta tand ndarrd 2004. Method for Antifungall Disk Dis isk Diffusion Susceptibility Testing Tesstiing oof Yeasts; Approved Guideline. NCCLS Pennsylvania. NCCL NC LS document M44-A. NCCLS, P en nns nsy y Toju, H., Tanabe, A.S., bee, A. A S., Yamamoto, S. S., dan Sato, H. 22012. 012 High-Coverage ITS 01 Primers for fo or the the DNA-Based DNADN A Ba B sed Identification Iden Id enti tifi f ca cati tion on of of Ascomycetes and Basidiomycetes Environmental Samples. ycettes iin n En Envi viro ronm nmen nta tall Sa Samp mple les. s. Journal Jourrna nall Plos Pl One. 7(7): e40863. Toyang, N.J., Ateh, Vargas, teh, E.N., Keiser, j.,, Varg rgas, M., Bach, H., Tane, P., Sondengam, L.B., Davis, Verpoorte, Toxicity, antimicrobial is, H., Bryant, J. dan nV erpoorte, R. 2012. T and Anthelmintic elmintic Activities off Vernonia guineensis Benth. (Asteraceae) crude extracts. Journal of Ethnopharmacology. 144:700-704 United States Department of Agriculture. 2015. Gymnanthemum amygdalinum (Delile) Sch.Bip. Dalam:Germplasm Resources Information Network (GRIN) Taxonomy for Plants. http://www.ars-grin.gov.4/cgibin/npgs/html/taxon.pl?419854. Diakses tanggal 23 Agustus 2015. Utomo, A.D., Rahayu, W.S., dan Dhiani, B.A.2009. Pengaruh Beberapa Metode Pengeringan Terhadap Kadar Flavonoid Total Herba Sambiloto. Pharmacy. 6(1): 58-69. Wallinger, C., Juen, A., Staudacher, K., Schallhart, N., Mitterrutzner, E., Steiner, E.M., Thalinger, B., dan Traugott, M. 2012. Rapid Plant Identification Using Species- and Group-Species Primers Targeting Chloroplast DNA. Plos One. 7(1):e29473
57
World Health Organization. 2000. Chapter 5.7.: Dichloromethane. Dalam:Air Quality Guidelines. Edisi kedua. WHO Regional Office for Europe, Copenhagen. Halaman 88. Xiang, J. 2014. Nan Fei Shu, Daun Obat Para Raja. http://www.jia-xiang.biz/nanfei-shu-daun-obat-para-raja/. Diakses tanggal 16 September 2015. Yeap, S.K., Ho, W.Y., Beh, B.K., Liang, W.S., Ky, H., Yousr, A.H.N., dan Alitheen, N.B. 2010. Vernonia amygdalina, an ethnoveterinary and ethnomedical used green vegetable with multiple bioactivities. Journal of Medicinal Plants Research. 4(25):2787-2812. Yucesoy, M., Guldas,, N.S.,, dan Yulug, g, N. 2001. Disk Diffusion Method for Fluconazole Susceptibility le Susceptibili lity ty Testing g of Candida albicans Strains. J Chemother. r. 13(2):161-166. 13(2):1611-166. Zhou, J., Xie, G., dan Encyclopedia dan Yan, Yan n, X. X. 22011. 011. En 01 Ency c cl cloped edia of Traditional Chinese Medicines – Molecular Pharmacological Mol olec ecul ular ar Structures, P harm ha rmac acollog ogica Activities, Natural Sources and Applications. Springer, Heidelberg. Halaman 465 dan ndd Ap Appl plic icat atio ions. Volume 5. Spring ger e , He Heid del eb 356. Zore, G.B., Thakre, A.D., Karuppayil, S.M. 2011. Terpenoids akre ak re, A .D., Jadhav, S., dan Karuppa ayil,, S. S inhibit Candida growth membrane ndid nd da albicans albicanss gr grow o th byy affecting affe af fecting me memb mbra ra integrity and arrest of cell cycle. Phytomedicine. le. e. Ph P ytomedicine. 118:1181-1190 8 11 8: 118 81-1190 Zwenger, S. dan Basu, Plant Terpenoids: and Future an Ba Basu su,, C. 22008. 008. 00 8. P laant T erpe er peno noid ids: s: Applications App Potentials. Biot Biotechnology Biology 3(1): 1-7. tec echn hnol olog ogyy and d Molecular M leecula Mo l r Bi Biol olog ogyy Reviews. Revi
LAMPIRAN 1
Gambar 9. Tanaman obat Nan Fei Shu Gambar 10 10. 0. Pena Pe Penampang nam m daun tanaman obat Nan Fei Shu ob bat Na
Gambar 11. Beragam ukuran daun tanaman obat Nan Fei Shu dari termuda (kanan) hingga sebelum layu (kiri) diatas kertas berukuran A4.
58
59
A B Gambar 11. Uji ji zona hambat pad pada adaa ko konsentrasi 200 mg/m mg/ml. (A) pengulangan I,II,III; ,III; (B) pengulangan penggul ulaangan IV, V
A B Gambar 12. Uji ji zona hambat pada pad da ko konsentrasi onsentrasi 100 mg/m mg/ml. (A) pengulangan I,II,III; pengulangan IV, ,III; (B) pengulanga an IV V, V
A B Gambar 13. Uji zona hambat pada konsentrasi 50 mg/ml. (A) pengulangan I,II,III; (B) pengulangan IV, V
60
A B Gambar 14. Uji ji zona hambat ppada adaa ko ad konsentrasi 25 mg/m mg/ml. (A) pengulangan I,II,III; ,III; (B) pengulangan penggul ulaangan IV, V
A B Gambar 15. Uji ji zona hambat pada pad da ko kontrol ontrol negatif, DMSO DMS (A) pengulangan I,II,III; pengulangan IV, ,III; (B) pengulanga an IV V, V I
III
II
IV V A B Gambar 16. Uji zona hambat pada kontrol positif, ketoconazole (A) pengulangan I,II,III; (B) pengulangan IV, V
LAMPIRAN 2 Tabel 3. Hasil identifikasi KG-SM ekstrak tanaman obat Nan Fei Shu Puncak Waktu Komponen Persentase keRetensi (%) (menit) 23 16,694 phytol 15,397 36 24,244 heneicosane 11,009 18 13,997 neophytadiene 9,885 22 15,33 hexadecanoic acid 8,959 24 17,026 9,12-octadecadienoic acid 8,571 32 22,786 nonacosane 4,591 14 13,328 cis-2-ethyl-2-hexen-1-ol 3,508 42 26,841 chondril chondrillasterol lla last ster erol ol 3,015 20 14,438 neop neophytadiene oph hytadiene 2,962 15 13,552 ppentacosane entacosan anee 2,882 16 13,633 (7 (7e)-1,8-dimethyl-7-dodecenyl 7e))-1, 1,8 8-di d meth thyl yl--7-dode d ceny nyl ace acetate 2,328 17 13,782 13,7 782 pl pluchidiol pluc uchi hid diol 1,951 41 26,427 26 6,427 27 22-methyl-7-phenylindole -methyl-7-phenylindol olee 1,872 40 226,185 6,1 185 2-ethylacridine 1,728 19 114,249 4,2 ,249 49 neophytadiene 1,486 37 24,7655 alpha -tocopherol 24 1,26 3-buten-2-one,4-(1,3,3-trimethyl-73-buten-2-one,4-(1,3,3-trime ethy hyl-7 7 oxabicyclo[4.1.0]hep-2-yl)oxab ox abic icyc yclo lo[4 [4.1 1.0 .0]h ]hep ep-2 2-yl y )3 9,859 9,85 9, 859 ,[1.alpha.,2.b ,[1.alpha.,2.beta.(z),6.alpha.] beta.(z),6.alpha.] 1,198 29 22,36 22,3 22 ,366 1, 1,5,9-undecatriene,2,6,10-trimethyl1,5, 5,99-un unde deca catr trie iene ne,2 ,2,6 ,6,1 ,10 0-tri rime meth thy 1,137 39 25,623 25,6 623 me methyl meth thyl yl (4-tert-butylphenoxy) (4-tert rt-bu butylp lphe heno noxy xy)) acetate aceta 1,098 46 28,058 1,2-bis(trim 1,2-bis(trimethylsilyl)benzene methy hylsilyl)benzene 1,094 48 29,772 1,2-bis(trim 1,2-bis(trimethylsilyl)benzene methy hylsilyl)benzene 1,092 13 12,842 3,6-octadien 3,6-octadien-1-ol,3,7-dimethylen-1 1-ol,3,7-dimethyl0,876 35 24,088 beta -tocoph -tocopherol her e ol 0,86 49 33,566 2-ethylacridine 0,799 10 12,19 chloromethyl 7-chlorononanoate 0,745 47 29,01 1,2-bis(trimethylsilyl)benzene 0,74 1-(2-methylcyclopent-1-enyl)-1-hydroxy9 11,655 2-propene 0,69 11 12,365 (trans)-2-azidocyclopentan-1-ol 0,689 21 14,85 triacontane 0,627 34 23,468 eicosane 0,608 n-cyano-n',n',n'',n''-tetramethyl-1,3,550 33,884 triazinetriamine 0,577 25 17,607 5-nitrouracil 0,452 12 12,615 nonadecane 0,427 2 9,204 1,4-diethylhexyl methoxyacetate 0,379 45 27,658 benzo[h]quinoline, 2,4-dimethyl0,379
61
62
6 8 43 27 7
10,861 11,531 27,082 21,386 10,961
26 31 33 1 5 44
20,353 22,614 23,304 9,033 10,127 27,243
4 28
10,071 22,098
30 38
22,4 22,471 ,471 7 25,109 25 5,109 09
2(4h)-benzofuranone, 5,6,7,7a-tetrahydro4,4,7a-trimethyl2-piperidinone 2-ethylacridine eicosane propane 1-naphthalenamine-5,8-13c2,5,6,7tetrahydro2-methyl-7-phenylindole 2-ethylacridine 2,3,5,-trimethylhexane nonadecane cyclotrisiloxane, y hexamethyly 1,5-dimethylcyclohexene-51,5-di ime metthylcyclloh ohex e ene-5carbocaldehyde ca arb rbocalde d hyde 22-nonadecanone -noona nadeca cano none ne benzoic benz be zoi oicc ac acid acid,2,4-dimethoxy-6-propyl-,4id,2 2,4-di 4 dime m th hox o y-6 6-prop carboxy-3-hydroxy-5-propylphenyl carb ca rboxy-3-hydroxy-5 5-pr p op opyl ylph phen e y ester 44'methyl-2phenylindole 'methyl-2phenylindole
0,358 0,338 0,328 0,319 0,318 0,316 0,306 0,304 0,286 0,263 0,248 0,243 0,22 0,142 0,14
LAMPIRAN 3 Tabel 4. Hasil analisis variasi (ANOVA) luas zona hambat aktivitas antifungal variasi konsentrasi ekstrak tanaman obat Nan Fei Shu, ketoconazole 1% (b/v), dan DMSO terhadap Candida albicans. Jumlah df Rerata F Sig. (cm2) (cm2) Antar 546,165 5 109,233 274,600 ,000 Kelompok Dalam 9,547 24 0,398 Kelompok Total 555,712 29 Tabel 5. Hasil Duncan uncan letak beda da nnyata yata luas zo zona hambat aktiv aktivitas antifungal variasi konsentrasi 1% (b/v), dan trasi ekstrak k ttanaman anamaan obat Nan Fei Fe Shu, ketoconazole keto DMSO terhadap Candida terhadaap Cand ndid ida albicans. albi al bica cans ns. ,a Duncan Perlakuan N Subset S ub untuk alfa = 0,05 1 2 DMSO 5 ,000000 200 mg/ml 5 ,000000 100 mg/ml 5 ,000000 50 mg/ml 5 ,000000 ,000 00000 0 0 25 mg/ml 5 ,000000 Ketoconazole 1% 1% 5 11,449000 b ) ( /v Sig. 1,000 0 1,000 Rerata dari grup pada subset yang hhomogen omog gen ditampilkan. a. Penggunaan 5,000 aan rerata ukuran sampel sam ampeel yang selaras = 5,00
63
64
Gambar 17. Kromatogram Hasil Kromatogram Cair Ekstrak
LAMPIRAN 4
65
Gambar 18. Hasil alignment sekuens hasil sekuensing dengan sekuens Gymananthemum amygdalinum yang diperoleh dari NCBI Genbank
LAMPIRAN 5
LAMPIRAN 6
Gambar 19. Kromatogram Sekuens DNA menurut Primer ITS 1
66
LAMPIRAN 7
Gambar Sekuens ar 20. Kromatogram S ek kuens DNA menurut Primer ITS 4
67
LAMPIRAN 8
68
69
70
Gambar Gamb mbar ar 221. 1. B BLAST LAST LA ST Sekuens Sek kuenss D DNA NA Nan Nan Fei Fe Shu
LAMPIRAN 9 Sekuens Gymnanthemum amygdalinum yang diperoleh dari NCBI GenBank (fasta format) >gi|40748098|gb|AY504695.1| Gymnanthemum amygdalinum internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence TCGATTAAAGCATTTCAGAATAACCTGTGAACATGTATTATTAT TTGGGTGTTGGGAGGACGGGCTAATGCTCTCACCCTCTTTGCAT CGTGTTGACATACACTTGTATAGCCTCTTWTTGGGTCGTACATG TGTCTTGTTAGCATTTAAACAAACCCCCGGCACAGAACGTGCCA C C GGG GCG C G AGGATGAACAAAACATTAAAAGGGTGCGACTTGTGATGCCCCG TATGCATTC CAG AGGTCGTG GGC G TTTTTTGT TTCGCGGTATGCATTCAGGTCGTGGCTTTTTTGTAATTACAAAC GGCAACG CGG GATA ATCTCGGCT TCA CACGCAT GACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAA AAAATG TGCGAT ATAC ACTT TTGG GGTG TGTG T AA ATT T GCA CGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGA AGT TTT TTTT TTGA GAAC ACG GCAA AGT GTTG T CG CGCC CCCG C A ACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGT CACG CGTC TCTG TGC CCTGGGCGTCAC CGC GCAT ATTG TGC CGAGGGCACGTCTGCCTGGGCGTCACGCATTGCATCGCCTCCTT TCC CCTT TTC CCTTAGTAGGCTTGTTGT GTTC TCGG GG CAATGCCTCCTTCCTTAGTAGGCTTGTTGTTCGGGGCGGAGATT CAT ATGC GCTGATGGTGTGGTTGGCCT CTAA AAA A GGTCTCCCATGCTGATGGTGTGGTTGGCCTAAACGTAACTCCCT GATA ACATGACTAGTGGTGGTTGA ACA AA TTCGGTGGATACATGACTAGTGGTGGTTGACAAGACCTTCGTTT TGT GTG GTCGTTAACCGTAAGGGAAA AAGG GGT T GGAGTTGTGTGTCGTTAACCGTAAGGGAAAGGTTGTAAAAATC GAGTC CGT TCT CTTA TATG TGAT ATGA GACG CGCT CTTC CGA A CCTTAATGAGTCGTCTTATGATGACGCTTCGA
71