2014

TUGAS TERSTRUKTUR TEKNIK PENELITIAN PRODUKSI TERNAK TA 2013/2014

Aplikasi Teknologi Molekuler Genetik Untuk Pemuliaan Ternak Dosen: Tety Hartatik, S.Pt., Ph.D.

PENANDA MOLEKULAR GENETIK PADA TERNAK DOMBA KETURUNAN BANGSA BRASIL, PAKISTAN, DAN AMERIKA SERIKAT

Oleh: Yanuar Achadri 13/352197/PPT/00832

PROGRAM PASCASARJANA FAKULTAS PETERNAKAN UNIVERSITAS GADJAH MADA YOGYAKARTA 2014

PENANDA MOLEKULAR GENETIK PADA TERNAK DOMBA KETURUNAN BANGSA BRASIL, PAKISTAN, DAN AMERIKA SERIKAT

PENDAHULUAN Identifikasi Penanda Molekuler di Bone Morphogenetic Protein15 (BMP15) pada Gen Domba Balochi Domba untuk meningkatkan sumber pasokan daging serta protein hewani. Pakistan kaya akan sumber daya genetik domba. Pakistan memiliki 28 keturunan domba yang diakui baik. Tujuan dari peningkatan populasi ternak ruminansia kecil adalah untuk menghasilkan kualitas daging dan untuk memenuhi permintaan konsumsi daging. Sehingga ternak yang memproduksi anak kembar atau triplet memberikan kontribusi lebih dari 1,5 kali terhadap daging dari hewan penghasil keturunan tunggal per beranak. Di antara beberapa keturunan domba, persentase twinning lemak ekor domba keturunan (Balochi) memiliki tingkat kesuburan 70-75 persen. Genetika prolifikasi pada domba menekankan pentingnya gen utama yang telah diketahui mempengaruhi tingkat ovulasi. Oleh karena itu, identifikasi gen utama memiliki efek yang besar pada tingkat ovulasi. Booroola dilaporkan sebagai gen besar pertama untuk meningkatkan tingkat ovulasi (Pennetier et al, 2004; Eckery et al., 2002). Kedua gen GDF-9 dan BMP-15 sebagai sumber-sumber gen di dalam oosit (Juengel et al., 2002). BMPR-1B adalah reseptor dari BMP yang berasal dari sel-sel granulosa dan oosit dari tahapan awal hingga akhir folikel antral yang berhubungan dengan folikel antral pada domba dan sapi (Souza et al, 2002;Wilson dkk, 2001; Kilau et al., 2004). Fungsi morfogenesis gen protein tulang 15 (BMP-15) apabila gen tersebut berkolaborasi untuk mengatur fungsi sel granulosa. Sebelumnya laporan ini telah dijelaskan bahwa sedikitnya lima mutasi pada gen ini mempengaruhi prolifikasi. Gen BMP15 memiliki peran vital dan diperlukan untuk folikulogenesis pada domba. Jika dua gen pembawa sama, replikasi

1

alami menonaktifkan mutasi BMP15 tidak subur dan perkembangan folikel akan diblokir di tahap utama. Dalam domba itu selanjutnya jelas bahwa jika heterozigot berarti menonaktifkan mutasi hanya satu replikasi gen BMP15, dimana yang lain salinan gen menghasilkan protein aktif, hal ini yang meningkatkan tingkat ovulasi (Galloway et al., 2000). Gen BMP15 adalah gen terkait-X dalam alam dan memudahkan untuk mengidentifikasi hewan produktif pada tahap awal kehidupan karena sebagai identifikasi FecB (Booroola) pada domba X kromosom. Penanda berkontribusi pada varians ekspresi sifat pada ternak. Jika penanda tersebut dapat diidentifikasi pada jenis domba Pakistan, maka identifikasi dan pemuliaan direncanakan pada hewan produktif yang tinggi sehingga mengakibatkan peningkatan populasi ternak ruminansia kecil. Oleh karena itu, perlu dilakukan penelitian pada gen BMP15 pada domba Balochi.

Data Microsatelit untuk Meta-Analisis Terhadap Keragaman Bangsa Domba di Amerika Serikat dan Brasil Awalnya, semua domba domestik diimpor ke Barat Hemisphere (WH; Dohner 2001). Hasil dari impor tersebut, berdampak terhadap sumber daya genetik yaitu kesamaan WH keturunan dengan negara asal yang sama. Hasil evaluasinya adalah populasi domba WH yang berbagi kesamaan fenotip tetapi dikenal oleh berbagai nama. Usulan dalam menggunakan dan mengatur penanda genetik untuk tujuan pemahaman keragaman genetik disarankan oleh Barker et al.( 1993). Sebagai akibatnya, Organisasi Pangan dan Pertanian (FAO) dan International Society mengusulkan seperangkat mikrospidol satelit untuk Genetika Hewan (Hoffmann et al.2004). Penilaian perbedaan genetik antara populasi ternak dengan mikrosatelit telah memberikan informasi penting mengenai domestikasi, pengembangan reproduksi, dan perbedaan reproduksi di seluruh wilayah geografis (Bruford et al 2003; Hanotte 2007). Ada beberapa pendekatan

2

untuk menyelesaikan tugas penggabungan Data mikrosatelit (Freeman et al, 2006; Presson et al. 2006, 2008). The Presson et al. (2006 , 2008) yang terdiri dari model Bayesian dan Rantai Markov Monte Carlo (MCMC) algoritma untuk pengambilan sampel distribusi posterior bawah kondisi model. Artinya, posterior probabilitas memberikan wawasan mengenai kepercayaan pada data gabungan, dimana pengguna dapat menentukan apakah merger hasilnya dapat diterima. Sampai saat ini, pendekatan seperti itu belum dimanfaatkan sepenuhnya pada studi keragaman genetik ternak tetapi data mikrosatelit diperlukan pada penelitian laboratorium. Program konservasi sumber daya genetika hewan nasional di Brazil dan di Amerika Serikat ingin menentukan persamaan dan perbedaan sejumlah populasi domba. Hal ini menguntungkan bagi kedua negara untuk menggabungkan data ini dan mengevaluasi perbedaan genetik atau kesamaan yang mungkin ada. Oleh karena itu, tujuan penelitian ini untuk menguji

penggabungan

data

set

mikrosatelit

untuk

meta-analisis

keragaman genetik yang ditemukan pada dua negara ini (Amerika Serikat dan Brasil).

Penanda Molekuler untuk Penelitian Keragaman Genetik dan Filogeni Domba Bangsa Brasil Domba

Brasil

berasal

dari

Portugis

dan

Spanyol

yang

diperkenalkan oleh penjajah. Selama bertahun-tahun, bangsa domba ini menjadi sasaran seleksi alam lingkungan lokal dan kondisi iklim, sehingga keturunan yang saat ini dianggap naturalisasi, diadaptasi secara lokal, atau asli (Mariante et al., 1999). Data sensus pertanian oleh Brasil Institut Geografi dan Statistik menempatkan populasi domba Brasil lebih dari 17 juta ekor, berpusat terutama di timur laut selatan dan wilayah negara. Naturalisasi breeds sering disukai karena berkarakteristik

dan mampu

beradaptasi di daerah iklim tropis dan subtropis, serta sebagai sumber daya genetik di masa depan.

3

Perlu dicatat bahwa hewan-hewan naturalisasi memiliki banyak sifat adaptif yang membuat mereka berguna untuk pemuliaan dan produksi, seperti: toleransi atau resistensi terhadap penyakit dan parasit, dan adaptasi luas terkait dengan ketersediaan dan kualitas sumber daya pangan dan air sebagai hewan yang lebih baik diadaptasi dan bereproduksi. Oleh karena itu, keturunan naturalisasi merupakan hasil proses seleksi alam jangka panjang. Program konservasi dan perbaikan genetik berfokus pada hewan naturalisasi, hal ini penting untuk menghindari kawin sedarah dan persilangan sembarang. Penelitian tentang sifat-sifat adaptif dari keturunan yang berbeda penting untuk mendukung sistem produksi ternak berdasarkan keturunan asli. Polimorfisme nukleotida tunggal (SNP) spidol memiliki mulai memberikan perspektif baru untuk penelitian genom, khususnya dalam penelitian keragaman dari genom individu dan populasi, dalam pencarian gen yang menyebabkan penyakit, dan identifikasi seleksi (Kijas et al, 2012; Pariset et al, 2012). Ulasan ini membahas evolusi penggunaan penanda molekuler dalam menganalisis keragaman genetik dan filogeni dari naturalisasi keturunan domba Brasil.

METODE EKSPERIMEN

Eksperimen 1: Identifikasi Penanda Molekuler di Bone Morphogenetic Protein15 (BMP15) pada Gen Domba Balochi Seleksi ternak dan ekstrasi DNA Lima puluh sampel darah domba Balochi diperoleh dari peternakan pemerintah yang berbeda (Karakul Sheep Breeding Farm Maslakh Quetta dan Sapi Bhagnari/ domba Balochi Pertanian Usta Mohammad District Jaffarabad Balochistan). Domba dipilih secara acak untuk menghindari hubungan kesetaraan maksimal. Lima puluh sampel domba Balochi disekuensing untuk penelitian ini. Sepuluh (10) ml sampel darah domba dikumpulkan aseptik dari vena jugularis dan tabung diisi antikoagulan

4

yaitu ethylene diamine tetra-asetat (0,5M EDTA). Sampel ditempatkan dalam es segera setelah dikoleksi dan dibawa ke laboratorium dan disimpan sementara dalam freezer pada -20 °C sebelum ekstraksi DNA. DNA diekstraksi oleh metode anorganik (Sambrook dan Russel, 2001). Kuantitas dan kualitas sampel DNA diukur.

Rancangan primer, optimasi dan PCR Rancangan primer spesifik untuk amplifikasi gen BMP15 dirancang menggunakan software Primer3 (www.http://bioinfo.ut.ee/primer3 - 0.4.0/). Primer yang dioptimalkan pada temperatur annealing. Primer diamplifikasi oleh gradien PCR di berbagai temperatur (64°C-54°C) digunakan dalam Bio-Rad thermo cycler. Suhu dimana primer menunjukkan hasil terbaik untuk diamati dan dipilih. PCR selanjutnya dioptimalkan suhunya. Reaksi berantai polimerase yang dilakukan dalam campuran reaksi 25 uL mengandung 50 mM KCl , 10 mM Tri-HCl (pH 8,0), 0.1 % Triton X-100 ,2.5 mM MgCl2, 200 M dari masing-masing dNTP, 2M dari masing-masing primer, 50 ng DNA genom yang berhubung dengan domba dan 1U Taq polymerase DNA. Amplifikasi kondisi untuk primer gen BMP15 adalah sebagai berikut: denaturasi pada 94°C selama 5 menit; diikuti 35 siklus denaturasi pada 94°C selama 30 detik; annealing pada 57°C selama 30 detik; dan ekstensi pada 72°C selama 30 detik; dengan ekstensi akhir pada suhu 72°C selama 10 menit pada BioRad thermocycler. Produk PCR dimurnikan oleh FavorPrep PCR pemurnian Mini kit untuk sekuensing.

Sekuensing DNA dan Analisis sampel sekuensing Produk PCR disekuensing dikedua arah menggunakan terminasi rantai dideoksi langsung. Sanger sekuensing pada ABI analisa genetik 3130. Urutan normal menggunakan versi perangkat lunak Bioedit (Balai et al., 1999). Urutan DNA dikonfirmasi oleh sekuensing dan helai antisense.

5

Eksperimen 2: Data Microsatelit untuk Meta-Analisis terhadap Keragaman Bangsa Domba di Amerika Serikat dan Brasil Mikrosatelit Set data Sampel AS berasal dari 28 keturunan (N=674) dan genotip dengan 28 lokus FAO (Blackburn et al. 2011), dan data Brazil (BZ) memiliki 10 keturunan (N=383) dan genotip oleh 22 Lokus (dari 11 panel FAO) (Paiva et al. 2006). Kedua set data negara yang diperoleh secara independen oleh platform genotip yang berbeda dengan pengecualian dari 23 sampel dari Brasil Hampshire yang genotip oleh kedua negara. Untuk sampel AS, sebuah perusahaan komersial (GeneSeek) dengan multisistem kompleks, diperkuat DNA, dan alel (Blackburn et al. 2011). Paiva et al. (2006) merinci koleksi dan genotip dari sampel Brasil. Genotipe diperoleh dengan elektroforesis kapiler pada ABI310 analyzer Genetik (Terapan Biosystems, Carlsbad, CA), dan genotip dan alel telah diperoleh dengan menggunakan Gene Scan dan Genotyper softwares (Applied Biosystems). Brasil telah mengimpor Hampshire pada tanuh 1990-an dari Kanada dan Amerika Serikat. Sebelas penanda yang umum untuk kumpulan data AS-BZ (HUJ616, ILSTS11, ILSTS5, INRA63, MAF214, MAF65, OarAE129, OarFCB20, OarFCB304 , OarJMP29 , dan SRCRSP5) dan digunakan untuk penggabungan dan evaluasi genetik .

Prosedur penggabungan Dua software dievaluasi. Pendekatan pertama COMBI.PL (Taubert dan

Bradley

2008)

berupaya

menggabungkan

set

Data

dengan

menetapkan ukuran alel di seluruh studi menggunakan estimasi kemungkinan maksimum. Yang kedua, MicroMerge v.2 (Presson et al. 2008), didasarkan pada pendekatan Bayesian dan meluruskan set data marker dengan marker, pencocokan masing-masing frekuensi alel penanda itu sambil menjaga ukuran. Berdasarkan asumsi dari kedua

6

pendekatan dan struktur kumpulan data, lebih memilih pendekatan Bayesian yang terkandung dalam MicroMerge v.2. Micromerge frekuensi alel antara set data lebih cocok daripada menggunakan ukuran alel. Software ini dijalankan menggunakan pilihan berikut: satu ke satu format, penggabungan

penanda

dengan

probabilitas

posterior

rendah,

menyesuaikan nomor alel, dan kesalahan genotip yang ditetapkan dari nilai (0.02) untuk nilai 0.06. Analisis ini dilakukan dengan burn-in 5000 iterasi dan 1.000.000-5.000.000 iterasi selama penggabungan data aktual (metode

MCMC).

Kriteria

untuk

penerimaan

konvergensi

untuk

probabilitas posterior. Nilai ini lebih tinggi dari MicroMerge 0,45.

Analisis Genetika Populasi Kumpulan data gabungan terdiri dari 38 keturunan dan 1057 hewan dengan genotipe untuk semua 11 penanda yang dipilih. Namun, untuk tujuan perbandingan antara negara, satu set data yang lebih kecil untuk analisis genetik adalah dipilih dan terdiri dari 21 keturunan, 12 dari Amerika Serikat, dan 9 dari Brasil (N=706). Bayesian digunakan untuk menentukan ke satu atau lebih populasi. Untuk estimasi ini, metode MCMC digunakan perhitungan untuk setiap individu satu genotipe tertentu '' X '' untuk menjadi bagian dari salah satu diberikan Populasi '' K '' sebagai logaritma natural: [ln Pr(X|K)]. Hipotesis kedua dianalisis dengan struktur yang memverifikasikekuatan penanda mikrosatelit untuk mengidentifikasi umum asal bulu domba. Perkiraan antara populasi dihitung dengan GENALEX 6 software (Peakall dan Smouse, 2006). Analisis varians molekul (ANOVA) adalah dengan software Arlequin (Excoffier dan Lischer, 2010) dengan menggunakan matriks kodominan alel dengan jarak 1000 permutasi, sebagai tes tambahan untuk mengidentifikasi struktur genetik dalam serangkaian kontras antara semua populasi yang diteliti. Indeks fiksasi (FIS) dan koefisien keragaman genetik dihitung menggunakan FSTAT (Goudet, 2002) dan Molkin (Gutie'rrez et al,. 2005).

7

Eksperimen 3: Penanda Molekuler untuk Penelitian Keragaman Genetik dan Filogeni Domba Bangsa Brasil Penanda molekuler Penanda molekuler dapat dianggap sebagai salah satu molekul fenotip berasal dari segmen DNA yang spesifik , dan sesuai dengan daerah yang diekspresikan dalam genom (Ferreira dan Grattaplaglia, 1996). Penanda molekuler yang memperkuat rantai DNA menggunakan polymerase chain reaction (PCR). Polimorfik digunakan dalam analisis keragaman genetik diperkuat panjang fragmen polimorfisme (AFLP), pembatasan fragmen panjang rantai polimorfisme-reaksi polimerase (PCR/ RFLP), random amplified polimorfik DNA (RAPD), mikrosatelit atau mengulangi urutan sederhana (STR), daerah seks menentukan Y (SRY) dan SNP. Teknik AFLP didasarkan pada PCR amplifikasi subset dari fragmen yang diperoleh dari situs-spesifik pembelahan DNA genom dengan tipe II enzim restriksi (Lopes et al., 2002). Teknik ini telah ditemukan efisien dalam studi keragaman genetik pada domba. PCR/ RFLP mendeteksi pola polimorfisme antara individu yang berbeda dan didasarkan pada perbedaan ukuran fragmen restriksi yang dihasilkan oleh endonuklease pembelahan daerah DNA diamplifikasi.

Mikrosatelit Mikrosatelit adalah penanda yang paling sering digunakan untuk mengeksplorasi keragaman genetik dan struktur populasi domestikasi ternak (Baumung et al., 2004). Evaluasi dari delapan mikrosatelit lokus polimorfisme lima keturunan domba yang tidak terkait (Romney, Border Leicester, Suffolk, Awassi, dan Australia dan Selandia Baru Merino) menunjukkan perbedaan yang sangat signifikan dalam frekuensi alel antara individu, menunjukkan bahwa penanda mikrosatelit dapat menjadi alat dalam mengevaluasi hubungan evolusi antara ras (Buchanan et al., 1994). Mikrosatelit untuk karakterisasi genotip dan menilai jenis domba 8

menjadi efisien untuk mengevaluasi keragaman genetik dan menghitung jarak genetik antara hewan. Beberapa studi telah menggunakan penanda mikrosatelit untuk meneliti keturunan Brasil lokal.

Penanda DNA mitokondria Mitokondria memiliki DNA melingkar mereka sendiri (mtDNA) dan kapasitas replikasi. Sekuensing mtDNA dapat digunakan sebagai alat untuk menentukan asal-usul evolusi dan dinamika populasi, dan berguna dalam studi domestikasi karena mtDNA memiliki tingkat mutasi yang tinggi. mtDNA telah digunakan untuk menyelidiki asal bovines.

Polimorfisme nukleotida tunggal (SNP) Penanda SNP yang digunakan dalam hubungan studi, petagenetik, tes diagnosa paternity, identifikasi individu (traceability), dan untuk mendeteksi penyakit genetik dan polimorfisme terkait dengan sifatsifat produksi. Namun, telah ada kemajuan yang signifikan dalam sekuensing genom mamalia dan dalam pengembangan alat bioinformatika selama dekade terakhir yang memiliki tingkat massal genotip SNP.

HASIL DAN PEMBAHASAN

Hasil 1: Identifikasi Penanda Molekuler di Bone Morphogenetic Protein15 (BMP15) pada Gen Domba Balochi Analisis statistik polimorfisme identik pada domba Balochi menunjukkan penyisipan tiga nukleotida (CTT) pada posisi 171.172.173 P-nilai 2.40E-04 dan penghapusan tiga nukleotida (TGA) pada nukleotida posisi 3477, 3478 , dan 3479 memiliki P-nilai 4.47E-03, 4.47E-03, 4.47E03, (Tabel I). P-nilai 3296 dan 4851 polimorfik diamati sebagai 5.16E-02 dan 8.03E-02.

9

Tabel 1. Analisa statistik identifikasi polimorfisme pada domba Balochi

Kodon modifikasi gen BMP15 pada domba Balochi disajikan pada Tabel II. DNA Analisis urutan gen BMP15 mengungkapkan penyisipan polimorfisme leusin (CTT) di domba Balochi pada kodon 10 dengan accessation # AF236078 untuk ekson 1 dan AF236079 untuk ekson 2. Setiap perubahan urutan DNA dikonfirmasi dengan sekuensing dan untai antisense. Tabel 2. Modifikasi kodon gen BMP15 pada domba Balochi

Berbagai penelitian tentang genetika prolifikasi pada domba menekankan pentingnya gen utama yaitu BMP15, BMPR1B dan GDF9. Ketiga gen penting yang telah diketahui mempengaruhi ukuran dan tingkat ovulasi melalui berbagai mekanisme BMP15 dianggap sebagai gen penting yang memiliki peran potensial dalam fekunditas domba. Gen BMP15 , juga disebut GDF9b , telah dipetakan ke domba X - kromosom yang terdiri dari 6648 panjang nukleotida penuh urutan coding dan berisi dua ekson yang dipisahkan oleh intron sekitar 5309 nukleotida dan mengkodekan protein dari 394 asam amino. Dalam studi ini, gen BMP15 10

dilakukan untuk mengidentifikasi polimorfisme dan hubungannya dengan litter size. Perubahan nukleotida pada posisi 3296 dari C > T berada di wilayah intronic dan itu adalah saat transisi polimorfisme pada posisi 4851 (T > G) juga di wilayah intronic tapi itu transversi. Analisa statistik mengidentifikasi polimorfisme pada gen BMP15 domba Balochi bahwa SNP, BMP15 adalah sangat signifikan (p=2.40E-04). SNP, BMS3-5, juga menunjukkan hasil yang signifikan, sementara SNP, BMS2 dan BMS6 ditemukan non signifikan. Berat molekul Protein BMP15 (AF236078-9) adalah 44.897,68 dalton sedangkan berat molekul protein subjek (Balochi domba) adalah 45.010,83 dalton. BMP15 protein dari domba Balochi adalah 113,15 dalton lebih berat dari protein query. Hasil ini menunjukkan bahwa perubahan dalam berat molekul mungkin memiliki pengaruh signifikan terhadap ekspresi gen. Ini tampaknya bahwa SNP diidentifikasi pada domba menunjukkan korelasi dengan gen BMP15. Selain identifikasi SNP dalam melakukan percobaan, ekspresi gen akan membantu untuk memahami

mekanisme

molekuler

dari

gen

untuk

mengendalikan

fekunditas pada domba. SNP diidentifikasi dalam studi ini dapat digunakan sebagai penanda genetik untuk kesuburan pada domba. Penanda genetik ini juga dapat dimasukkan ke dalam evaluasi genetik atau seleksi buatan.

Hasil 2: Data Microsatelit untuk Meta-Analisis terhadap Keragaman Bangsa Domba di Amerika Serikat dan Brasil Berdasarkan kriteria konvergensi preset, metodologi Bayesian untuk menggabungkan 2 set data berhasil dan muncul kuat. Untuk set data, probabilitas posterior dari masing-masing lokus berkisar 0,6-1,0 dan 0,5-0,98 dengan dan tanpa sampel bersama (Tabel 3). Jumlah alel diamati dalam keturunan AS selalu lebih tinggi dari keturunan Brasil mungkin karena jumlah bibit dan ukuran sampel yang lebih besar. Setelah penggabungan prosedur, jumlah alel untuk matriks terpadu genotip seperti

11

yang diharapkan memiliki kecenderungan untuk dikurangi, kecuali untuk penanda ILSTS11 dan SRCRSP5. Tabel 3. Hasil penggabungan 11 mikrosatelit dari 2 data genotip domba oleh AS dan Brazil

Keragaman genetik di antara keturunan menunjukkan bahwa kedua negara memiliki rentang yang sama untuk jumlah rata-rata alel dan (heterozygosis). Namun, bangsa Brasil memiliki tingkat tinggi Ho (diamati heterozygosis). Inbreeding terendah adalah koleksi keturunan Brasil, sedangkan nilai-nilai untuk beberapa populasi AS secara signifikan lebih besar. Bulu dan rambut kasar keturunan wooled cenderung memiliki tingkat yang lebih tinggi keragaman genetik daripada keturunan yang berbulu, kecuali Rambouillet dan Navajo Churro.

Hasil 3: Penanda Molekuler untuk Penelitian Keragaman Genetik dan Filogeni Domba Bangsa Brasil Studi Random Amplified Polimorfik DNA (RAPD) didasarkan pada reaksi

rantai

polimerase,

menggunakan

homolog

primer

untuk

menargetkan situs di genom. Penanda ini membantu dalam mengartikan pola variasi genetik dan dapat digunakan untuk konservasi langsung untuk spesies terancam atau hampir punah. Meskipun banyak keuntungan untuk

12

penggunaan penanda ini, ada juga beberapa kelemahan dalam hal reproduktifitas rendah dan pembentukan dari heteroduplex merupakan karakteristik dari dominasi, tetapi sejumlah peneliti telah menunjukkan efisiensi teknik ini dalam studi keragaman genetik domba yang berkembang biak di Pakistan (Qasim et al., 2011), India (Kumar et.al., 2003), dan Turki (Elmaci, 2007). SNP didasarkan pada perubahan dasar di molekul DNA, yaitu mutasi pada nukleotida tunggal (adenin, sitosin, timin, guanin), dan bialel, yaitu, hanya dua varian umumnya ditemukan dalam spesies tunggal (seperti alel yang sesuai dengan pasangan basa A /T dan yang lain untuk G/C). SNP sangat melimpah dalam genom spesies non - endogamic dan dapat terjadi pada coding daerah atau dengan fungsi-fungsi pengaturan meskipun, dalam banyak kasus ditemukan dalam intergenik daerah spacer. Sampai saat ini, teknik standar prospek untuk SNP penanda didasarkan pada metode sekuensing Sanger meskipun generasi kedua teknologi sekuensing (Roche 454-Margulies et al, 2005; Solexa-IlluminaBennett, 2004; dan ABI Padat-Valouev et al., 2008) kini dapat menghasilkan set data yang besar (pada urutan jutaan sekuensing basa). Beberapa studi telah menggunakan penanda mikrosatelit untuk meneliti keturunan Brasil lokal. Penanda mikrosatelit digunakan selama 18 lokus genetik untuk mengevaluasi keragaman pada domba baik naturalisasi dan eksotis (Santa Ines, Bergamacia, Rabo Largo, Morada Nova, dan Somalia) dan hasil yang efisien dalam karakterisasi keturunan, meskipun mereka menunjukkan variabilitas genetik yang

rendah.

Mikrosatelit telah terbukti penanda sangat baik untuk karakterisasi keturunan

naturalisasi

dan

dalam

studi

populasi.

Data

penanda

mikrosatelit direkomendasikan untuk pengujian paternity, keragaman genetik, dan variasi domba oleh FAO. Ketika daerah kontrol DNA mitokondria (mtDNA) disekuensing untuk mengidentifikasi filogenetik relativitas antara naturalisasi dan komersial domba Brasil, nilai keragaman nukleotida ditemukan menjadi

13

0,005 (Silverio et al., 2006). Hasil ini menunjukkan bahwa nilai-nilai mtDNA AMOVA lebih besar daripada penanda nuclear. Naturalisasi keturunan Brasil menunjukkan penyimpangan dari netralitas selektif, sebagai diuji oleh Fu’s Fs (p <0,01), menunjukkan bahwa populasi ini mengalami ekspansi demografis.

DISKUSI

Hasil penelitian menunjukkan bahwa perubahan berat molekul memiliki pengaruh signifikan terhadap ekspresi gen. Ini terlihat bahwa SNP diidentifikasi pada domba menunjukkan korelasi dengan gen BMP15. Selain identifikasi SNP dalam melakukan percobaan, ekspresi gen akan membantu untuk memahami mekanisme molekuler dari gen untuk mengendalikan fekunditas pada domba. SNP diidentifikasi dalam studi ini dapat digunakan sebagai penanda genetik untuk kesuburan pada domba. Menurut Praebel (2014), selama beberapa tahun terakhir peralatan laboratorium dan teknik yang digunakan untuk menyelidiki genom spesies hewan ternak telah berkembang sangat pesat. Sekarang mungkin untuk menganalisis secara simultan ratusan ribu penanda DNA (menggunakan begitu-disebut

teknik

SNP

Microchip,

SNP,

Single

Nucleotide

Polymorphism), dan untuk urutan DNA dari seluruh genom dari per individu. Menggunakan informasi genom ini, gen kunci dapat ditemukan dan ditandai yang mempengaruhi sifat-sifat yang berbeda hewan seperti hasil produktif, pertumbuhan, tahan penyakit dan kesuburan. Metodemetode baru ini akan memberikan informasi penting tentang sumber daya genetik hewan dan tentang pentingnya berbagai keturunan untuk pemeliharaan spesies-tingkat keanekaragaman hayati. Metode

mikrosatelit

pada

metodologi

Bayesian

untuk

menggabungkan 2 set data berhasil dan muncul kuat pada perbandingan domba AS dan Brasil. Jumlah alel diamati dalam keturunan AS selalu

14

lebih tinggi dari keturunan Brasil mungkin karena jumlah bibit dan ukuran sampel yang lebih besar. Mikrosatelit telah terbukti penanda sangat baik untuk karakterisasi keturunan

naturalisasi

dan

dalam

studi

populasi.

Data

penanda

mikrosatelit direkomendasikan untuk pengujian paternity, keragaman genetik, dan variasi domba oleh FAO. Domba sering disimpan dalam sistem input produksi yang rendah, seringkali pada tingkat subsisten. Namun, program pemuliaan yang efektif ada di sejumlah negara, yang terbesar di Australia dan Selandia Baru yang bertujuan untuk perbaikan genetik daging dan karakteristik wol serta tahan penyakit dan fekunditas. Kemajuan telah dibuat pada pemetaan gen domba dengan penanda yang terdiri lebih dari 1.200 mikrosatelit, dan urutan genom bersama-sama dengan polimorfisme nukleotida tunggal (SNP) diharapkan dalam waktu satu tahun. Upaya penelitian yang signifikan ke dalam sifat kuantitatif lokus (QTL) sedang berlangsung dan sejumlah tes gen domba komersial sudah tersedia, terutama untuk efek gen tunggal tetapi beberapa untuk otot-otot dan perlawanan penyakit. Integrasi informasi genotip menjadi evaluasi komersial genetik dan strategi seleksi optimal merupakan tantangan yang layak untuk pembangunan (Werf, 2013).

15

KESIMPULAN

Gen

BMP15

memiliki

peran

vital

dan

diperlukan

untuk

folikulogenesis pada domba. Jika penanda tersebut dapat diidentifikasi pada

jenis

domba

Pakistan,

maka

identifikasi

dan

pemuliaan

direncanakan pada hewan produktif yang tinggi sehingga mengakibatkan peningkatan populasi ternak ruminansia kecil. Penilaian perbedaan genetik antara populasi ternak dengan mikrosatelit

memberikan

informasi

penting

mengenai

domestikasi,

pengembangan dan perbedaan reproduksi di seluruh wilayah geografis. Metodologi Bayesian untuk menggabungkan dua kelompok data berhasil dan muncul kuat pada domba breed Amerika Serikat dan Brasil. Penanda molekuler untuk keragaman genetik dan filogeni pada domba Brasil yang sesuai dengan mikrosatelit. Mikrosatelit telah terbukti penanda sangat baik untuk karakterisasi keturunan naturalisasi dan dalam studi populasi.

16

REFERENSI

Crispim BA, Matos MC, Seno LO, Grisolia AB. 2012. Molecular Markers for Genetic Diversity and Phylogeny Research of Brazilian Sheep Breeds. African Journal of Biotechnology, Vol.11 (90), pp. 1561715625. Khosa AN, Babar ME, Nadeem, Asif. 2013. Identification of Molecular Markers in Morphogenetic Protein 15 (BMP15) Gene of Balochi Sheep. Pakistan Journ. Zool, Vol.45 (5), pp.1351-1357. Paiva SR, Mariaente AS, and Blackburn HD. 2011. Combining US and Brazilian Microsatellite Data for a Meta-Analysis of Sheep (Ovis aries) Breed Diversity: Facilitating the FAO Global Plan of Action for Conserving Animal Genetic Resources. Journal of Heredity: 102 (6): 697-704. The American Genetic Association. Praebel, Anne. 2014. Molecular Characterization Using DNA Markers. http://www.nordgen.org/index.php/en/content/view/full/1738. Diakses 18 April 2014 Werf, Julius. 2013. Marker Assisted Selection in Sheep and Goat, Chapter 13. http: //ftp.fao.org/docrep/fao/010/a1120e/a1120e04.pdf. Diakses 18 April 2014.

17

Pakistan J. Zool., vol. 45(5), pp. 1351-1357, 2013

Identification of Molecular Markers in Bone Morphogenetic Protien15 (BMP15) Gene of Balochi Sheep Ahmad Nawaz Khosa,1 Masroor Ellahi Babar,2 Asif Nadeem,3 Tanveer Hussain,3 Farah Bilal,3 * Khalid Javed2 and Khushi Muhammad4 1 Faculty of Veterinary and Animal Sciences, Lasbela University of Agricuture, Water and Marine Sciences, Uthal, Balochistan, Pakistan 2 Deparment of Livestock Production, University of Veterinary and Animal Sciences, Lahore 3 Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore 4 Department of Microbiology, University of Veterinary and Animal Sciences, Lahore Abstract.- Balochi sheep is more prolific than other breeds of sheep found in Pakistan. Fertility rate in Balochi is 70-75%. A study was carried out on BMP15 gene of Balochi sheep. Sequencing data analysis revealed an insertion of three nucleotides CTT at nucleotide position 171, 172,173, and a deletion of three nucleotides TGA at nucleotides position 3477, 3478, and 3479 of BMP15 gene. Two polymorphism in nucleotide positions 3296 C>T and 4851 T>G were also identified. This study could provide basic molecular data on the reproductive characteristics and a scientific basis for the conservation and utilization of sheep breeds. Key Words: Bone morphogenetic protein 15, BMP15, polymorphisim, nucleotide aligment.

INTRODUCTION

S

heep provide good scope for enhancing the supply of meat as well as animal protein. Pakistan is rich in sheep genetic resources. Pakistan has well recognized 28 sheep breeds. The purpose of small ruminant raisings is to produce quality meat to fulfill the demand of meat consumption. At present, there are 28.8 million sheep in Pakistan (Economic Survey of Pakistan, 2012-13). The importance of small ruminants in general and high prolific animals in particular, is greatly increased in Pakistan due to ever increase in the population during the last decade. It is an established fact that an animal producing twins or triplet contributes more than 1.5 times toward meat than the animals producing single offspring per lambing. Among the some sheep breeds, the twinning percentage in fat tailed sheep breeds (Balochi) had the fertility rate as 70-75 percent (Rafiq and Munir, 1983). Due to low heritability of litter size, attempts to increase litter size by selection within a breed results in slow progress (Morris, 1990). Genetics of prolificacy in sheep _________________________ *

Correspondance author: [email protected]

0030-9923/2013/0005-1351 $ 8.00/0 Copyright 2013 Zoological Society of Pakistan

emphasize the importance of main genes which have been made known to affect litter size and rate of ovulation through various mechanisms. Therefore, the identification of major genes which have great effects on ovulation rate and litter size has generated substantial interest among sheep breeders and scientists. Booroola is reported as the first major gene to enhance ovulation rate (Pennetier et al., 2004; Eckery et al., 2002). The two genes GDF-9 and BMP-15 have made their sources in oocytes (Juengel et al., 2002). The BMPR-1B receptor of BMP is expressed by granulosa cells and the oocytes from the early to the late antral follicle stages and to a slighter amount by theca layer of ovine and bovine antral follicles (Souza et al., 2002; Wilson et al., 2001; Glister et al., 2004). The function of gene bone morphogenetic protein 15 (BMP-15) is not absolutely appreciated or understood even if gene collaborate to regulate granulose cells function (McNatty et al., 2005). Earlier the present report have been described that at least five mutations in this gene affect the prolificacy. BMP15 gene has a vital role and necessary for folliculogenesis in sheep. If the same gene carrying two copies of naturally occurring inactivating BMP15 mutations are infertile and the follicular development will be blocked at the primary stage. In sheep it is furthermore clear that if heterozygotes mean carrying inactivating mutation

1352

A.N. KHOSA ET AL.

in only one copy of BMP15 gene, whereby the other copy of the gene produces active protein, this situation likely increased ovulation rate (Galloway et al., 2000). BMP15 gene is an X-linked gene in nature and it had made so easy to identify high prolific animals at an early stage of life because of the identification of FecB (Booroola) marker on sheep X chromosome. Markers that appreciably contribute to the variance of trait expression in livestock have been increasingly a focus in the field of livestock genetics. If such markers can be identified in Pakistani sheep breeds, identification and planned breeding of high prolific animals will result in fast vertical expansion of small ruminants and hence mutton prduction. There is comparatively less scientific knowledge available on small ruminants in this regard, and not a single study is done in Pakistan. Therefore, the present study deals with the fecundity gene Bone Morphogenetic Protein 15 (BMP15) in Balochi sheep. MATERIALS AND METHODS Animal selection and DNA extraction To study the genetics of fecundity in sheep, fifty individuals of Balochi sheep with different families having no blood relation were examined. The blood samples of Balochi sheep were obtained from different Government Livestock farms (Karakul Sheep Breeding Farm Maslakh Quetta and Bhagnari cattle/Balochi sheep Farm Usta Mohammad District Jaffarabad Balochistan). Sheep having single and multiple births history were selected for blood collection. These animals were selected randomly avoiding the relationship equivalency at maximum. Fifty samples of Balochi sheep were sequenced for the present investigation. This type of selection of animals provides a unique research material to identify molecular markers associated with fertility. Ten (10) ml blood sample was collected aseptically from jugular vein of selected sheep in the tubes containing anticoagulants i.e. Ethylene diamine tetra-acetic acid (0.5 M EDTA). Field samples were placed in ice immediately after their collection and brought to the laboratory and stored temporarily in freezer at -20°C before DNA extraction. DNA was extracted by inorganic method (Sambrook and Russel, 2001).

Quantity and quality of the DNA samples was measured. Primer designing, optimization and polymerase chain reaction Specific primers for the full length amplification of BMP15 gene were designed using software Primer3 (www. http://bioinfo.ut.ee/ primer3-0.4.0/). Sequence and product size of the primers are given in Table I. Genome browser web facility of the already reported sequence of these genes available at NCBI was used. Primers were optimized for their annealing temperature. Primers were amplified by a temperature gradient PCR in which a range of annealing temperature (64°C to 54°C) was used in Bio-Rad thermo cycler. The temperature at which primer showed best results were observed and selected. The subsequent PCR were carried out at optimized annealing temperatures. Polymerase chain reactions were carried out in a 25 µL reaction mixture containing 50 mM KCl, 10 mM Tris-HCl (pH 8.0), 0.1% Triton X-100, 2.5 mM of MgCl2, 200 µM of each dNTP, 2 µM of each primer, 50 ng of ovine genomic DNA, and 1U of Taq DNA polymerase. The amplification conditions for primers of the BMP15 gene were as follows: denaturation at 94°C for 5 min; followed by 35 cycles of denaturation at 94°C for 30 sec; annealing at 57°C for 30 sec; and extension at 72°C for 30 sec; with a final extension at 72°C for 10 min, on a BioRad Thermocycler. PCR products were purified by FavorPrep PCR purification mini kit for sequencing. Standard method was followed as described by manufacturer. DNA sequencing and analysis PCR products were sequenced in both directions using dideoxy chain termination direct Sanger sequencing on ABI genetic analyzer 3130. The sequence was blast against normal sequence by using Bioedit software version (Hall et al., 1999). Sequences were aligned with and change in the DNA sequence was confirmed by sequencing both sense and antisense strands. Analysis of sequencing samples The sequence was also blast against normal sequence by using Bioedit software version

MOLECULAR MARKERS IN BMP15 GENE OF SHEEP

1353

Table I.- List of Primers of BMP 15 Gene Serial #

Direction

Primer

1

Fec9bGSF1 Fec9bGSR1 Fec9bGSF2 Fec9bGSR2 Fec9bGSF3 Fec9bGSR3 Fec9bGSF4 Fec9bGSR4 Fec9bGSF5 Fec9bGSR5 Fec9bGSF6 Fec9bGSR6 Fec9bGSF7 Fec9bGSR7 Fec9bGSF8 Fec9bGSR8 Fec9bGSF9 Fec9bGSR9 Fec9bGSF10 Fec9bGSR10 Fec9bGSF11 Fec9bGSR11 Fec9bGSF12 Fec9bGSR12 Fec9bGSF13 Fec9bGSR13 Fec9bGSF14 Fec9bGSR14 Fec9bGSF15 Fec9bGSR15 Fec9bGSF16 Fec9bGSR16 Fec9bGSF17 Fec9bGSR17 Fec9bGSF18 Fec9bGSR18 Fec9bGSF19 Fec9bGSR19 Fec9bGSF20 Fec9bGSR20 Fec9bGSF21 Fec9bGSR21 Fec9bGSF22 Fec9bGSR22 Fec9bGSF23 Fec9bGSR23 Fec9bGSF24 Fec9bGSR24 Fec9bGSF25 Fec9bGSR25 Fec9bGSF26 Fec9bGSR26 Fec9bGSF27 Fec9bGSR27 Fec9bGSF28 Fec9bGSR28 Fec9bGSF29 Fec9bGSR29

CTGCCAGCCTTTCATTTTTC TTTTCCCTAGGGTGTCCACTT CTGCCAGCCTTTCATTTTTC TGCCCTACCTGTGTCATTTG GATTCAGGAGCTGCTAGAAGAA TGAAGCCTGACAGAAAACTGA AGGCCGCTGGCTAGTGTAG AACAGCCCTCCACAGAACAT GGCAACTCATTGATGTGTCAG AAGCTCAACTCCTGCCTCTG CTGCTTAGCTGTCCTGAAAGG TTCCCTAGAGAACCCTGCAC GACTATGTTGCTAGTTTGGGTTTG TTGGGGAGGATTAAGGAAGA CCTCCCTCCTCCAAGTAAAA CTGAGCTTCATTTTCTTCACCT CAGGGATCAAACCCACATCT AGCCCCAGGAATCCTACTGT TTGGGGTTGGGTATAAAAAGG TCACATTCCAACACCCAGAA TGGATACAGGGAGGGAAGTG TTTCCACCTTTAGGCCTTTG GAGGTGACATTTGAGCTGAGG CCATTTCTGGATCCTTTCCA TCATAAGCTGCATAAGTCAATTCT ACCCTGCCTGAAAAGGAA CACCCTGCTTCAGGAAATATG GACCCGCTGGTAAACACTAATC AAGCATGAGTTGGAACCTGAA TCTCCACTGAATCCATGAGC TTTTGCACCTGAAACTTGGA TTGATACTTCTCCCGGCAAT GCTGTATATTGTCACCCTGCTT CTTTCCTTCCAAGGAGCAAG CATCTGGTCCCATCACTTCA GACTGGTTGGATCTCCTTGC TCAAGGCTATGGTTTTTCCAG TTCTGGAGTTCACCCAAACC CCACCTGATGTGAAGAGCTG AAAGCGTTGAAAAGCAGGAC TGAACTGAACTGATGGTTAGTGA TTGAAAGTGAAAGTCGCTCA GTTGGTAAGATCCCTGGAGAAG GGTTGGAGATGCCACAAAAT GGAACGGAAAAGAGGGAGAT CCCCTAGACGGAGAAAAACA TTCATATGTTTCAATGACCCTCTT GCTCTTGAATCCACAATAGCC AAACACTGGCTTGTGTGTCCT TATGCTACCCGGTTTGGTCT GCTTTGCTCTTGTTCCCTCT TGCCACCAGAACTCAAGAAC CCCAAAACTTGGACAGAGATG ATGCAATACTGCCTGCTTGA ACTCAGAGTGTTCAGAAGACCAAA CTGGGCAATCATACCCTCAT AGTGTTCCCTCCACCCTTT GCCTCAATCAGAAGGATGCTA

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

Length

Products Size (bp)

20 21 20 20 22 21 19 20 21 20 21 20 24 20 20 22 20 20 21 20 20 20 21 20 24 18 21 22 21 20 20 20 22 20 20 20 21 20 20 20 23 20 22 20 20 20 24 21 21 20 20 20 21 20 24 20 19 21

420 274 420 420 420 420 420 420 420 420 420 420 420 420 420 420 420 474 420 420 377 420 420 376 420 420 420 488 348

1354

A.N. KHOSA ET AL.

A

G

A A T C

C T

T C

T

T C

T

T

T

G

G G G

A

C T

G

G

Fig. 1. Electropherogram of the identified insertion in Balochi sheep at nt position 171, 172, 173(CTT)

A T A C A G A T G T T G A A T T A T G A A

T T A T G A T T A T G A A

Fig: 2. Electropherogram of the identified deletion in Balochi sheep at position number 3477, 3478, 3479 (TGA) Table II.-

Identified polymophism in Blaochi sheep.

Sr. No

SNP ID

SNPs Position

Ref. Nucleotide

Nucleotide Change

1 2 3 4 5 6

BMS1 BMS2 BMS3 BMS4 BMS5 BMS6

Ins(171,172,173) 3296 3477 3478 3479 4851

C T G A T

CTT T Del Del Del G

(Hall et al., 1999). Sheep sequences were aligned with accessation # AF236078 for exon 1 and AF236079 for exon 2. Any change in the DNA

Exonic/Intronic Exonic Intronic Intronic Intronic Intronic Intronic

Transition/ Transversion Transition Transversion

sequence was confirmed by sequencing both sense and antisense strands. Analysis of the sequences was done with the help of appropriate softwares.

MOLECULAR MARKERS IN BMP15 GENE OF SHEEP

1355

RESULTS

DISCUSSION

Identified polymorphic sites in Balochi sheep breeds are shown in Table II. Sequencing data analyses revealed that in the exonic region an insertion of three nucleotides CTT at nucleotide position 171, 172, 173, and a deletion of three nucleotides TGA at nucleotides position 3477, 3478, and 3479 of BMP15 gene were observed in the intron, a transition nucleotide positions 3296 C>T and a transversion 4851 T>G were also observed in the intron. Statistical analysis of identical polymorphism in Balochi sheep shows an insertion of three nucleotide (CTT) at position 171,172,173 had Pvalue 2.40E-04 and deletion of three nucleotides (TGA) at nucleotide position 3477, 3478, and 3479 have the P-value 4.47E-03, 4.47E-03, 4.47E-03, respectively (Table III). P-value of 3296 and 4851 polymorphic sites were observed as 5.16E-02 and 8.03E-02. Codon modification of BMP15 gene in Balochi sheep is presented in Table IV. DNA Sequencing analysis of BMP15 gene revealed an insertion polymorphism of leucine (CTT) in Balochi sheep at codon 10.

In the earlier period, escalating the number of lambs born in the flock was mostly inadequate due to the use of the breeding program. No doubt, selection can play an important role but it is significantly slower process and may take decades to make almost 20% improvements in prolificacy. Despite this, nowadays molecular markers offers a new option that can allow the commercial producer to create a high level of prolificacy and still retain the important other traits such as high prolificacy, lamb growth rate, carcass and heavy quality fleece are all desired in the flock.

Table III.-

Statistical analysis of the polymorphism in Balochi sheep.

identical

S. No.

SNP ID

Chromosomal position

P-Value

1 2 3 4 5 6

BMS1 BMS2 BMS3 BMS4 BMS5 BMS6

Ins(171,172,173) 3296 del 3477 del 3478 del 3479 4851

2.40E-04 5.16E-02 4.47E-03 4.47E-03 4.47E-03 8.03E-02

Table IV-

Codon modifications of BMP15 gene in Balochi sheep.

SNPs position # Codon # Reference sequence Changed sequence Reference amino acid Changed amino acid

171, 72, 73 100 CTT Insertion Leucine

The genetics of sheep litter size has been well documented with a number of imperative prolificacy genes of sheep. Various studies on the genetics of prolificacy in sheep emphasize the importance of main genes namely BMP15, BMPR1B and GDF9. These three important genes which have been known to affect litter size and rate of ovulation through various mechanisms (Davis, 2005). BMP15 (Bone Morphogenetic Protein 15) is considered the important gene having the potential role in the fecundity of the sheep. BMP15 gene, also called, GDF9b, has been mapped to the sheep Xchromosome comprising 6648 nucleotide full length coding sequence and contains two exons which are separated by an intron of about 5309 nucleotides and encodes protein of 394 amino acid (Galloway, et al., 2000). In this study, fine mapping of BMP15 genes was performed to identify the polymorphism and their association with litter size. Balochi sheep breed of Pakistan was selected to see the nucleotide picture of this gene. It is well reported that BMP15 gene has significant role in fecundity so a number of polymorphism, insertion and deletion in Balochi sheep breed was identified and correlated with litter size of the sheep. A lot of work has been reported on sheep BMP15 gene but polymorphism is not abundant. In the present research, various polymorphisms, insertion and deletion in Balochi sheep breeds were identified and associated with fecundity and secondly, some novel polymorphisms were identified which are different from the sheep breeds of the world. These novel polymorphism will

1356

A.N. KHOSA ET AL.

be helpful to identify the region of the sheep breeds of the world. Sequences of same gene from Balochi sheep breed has also been submitted to the NCBI GenBank and given the accession # JN655672. Selected sheep breed for the research are very well known breed of Pakistan. The Balochi sheep is highly fertile with almost 70-75% fertility. In balochi sheep breed, litter size was 1.21 respectively. For the fine mapping and identification of polymorphism in the BMP15 gene, 29 pairs of primers were used for amplification to cover the whole region of the gene. Amplified product was sequenced and aligned to identify the polymorphism. Sequence of sheep breed was aligned with accession # AF236078 for exon-1 and accession # AF236079 for exon-2. Nucleotide sequence of BMP15 gene (Genebank accession # AF236078 for exon-1 and accession # AF236079 for exon-2) was reported for Ovis aries at NCBI so the different accession number for sheep sequence alignment was applied. Investigated polymorphism, deletion and insertion at the region of BMP15 gene in Balochi are presented in Table II. Insertion of three nucleotide (CTT) at the position of 171 nucleotide was identified. Deletion of three nucleotides at the position of 3477-3479 was also observed. Insertion of the three series nucleotide (CTT) was in the exonic region while deletion of three series nucleotide was in the intronic region. These series type insertions and deletions were surprising. This novel insertions and deletions in this gene have not been reported earlier. Change in nucleotide at position 3296 from C > T was in intronic region and it was the transition while polymorphism at 4851 position (T > G) was also in intronic region but it was the transversion. Statistical analysis of identified polymorphism in BMP15 gene of the Balochi sheep revealed that SNP, BMS1 was highly significant (p= 2.40E-04). SNP, BMS3-5, also showed the significant results while SNP, BMS2 and BMS6 were found non significant. Electropherogram of the identified polymorphism in balochi sheep were also presented and change in nucleotide was marked with arrow sign. Nucleotide alignment of Balochi sheep with query was aligned and change in nucleotide was mention. Change in the amino acid affects the molecular weight of

protein and ultimately may alter the expression of the gene at cellular level. Molecular weight of BMP15 protein (AF236078-9) was 44897.68 daltons while molecular weight of subject protein (balochi sheep) was 45010.83 daltons. BMP15 protein of the balochi sheep was 113.15 daltons heavier than the query protein. These results showed that this change in molecular weight may have significant effect on the expression of the gene. This appears to agree that identified SNPs in sheep shows correlation with BMP15 gene. Because of the lack of functional data and small population size used, the conclusion requires further studies on litter size in different parities. Besides the identification of SNP in conducted experiment, gene expression patterns dependent study will help to understand the molecular mechanisms of these genes to controlling the fecundity in sheep. Identified SNPs in this study can be used as genetic marker for fecundity in sheep breeds. These genetic markers can also be incorporated into genetic evaluation or artificial selection. ACKNOWLEDGEMENTS Special thanks are due to Directorate of Livestock Farms and Directorate of Research, Livestock and Diary Development Department, Balochistan, Superintendant Karakul Sheep Farm Maslakh at Quetta, and Superintendant Bhagnari Cattle/Balochi sheep Farm Usta Mohammad, Balochistan for helping in sample collection. REFERENCES ECONOMIC SURVEY OF PAKISTAN. 2012-13. Finance Division, Economic Advisor Wing, Government of Pakistan, Islamabad. DAVIS, G.H., 2005. Major genes affecting ovulation rate in sheep. Genet. Sel. Evol., 37: 11-23. ECKERY, D.C., WHALE, L.J., LAWRENCE, S.B., WYLDE, K.A., McNATTY, K.P. AND JUENGEL. J.L., 2002. Expression of mRNA encoding growth differentiation factor 9 and bone morphogenetic protein 15 during follicular formation and growth in a marsupial, the brushtail possum (Trichosurus vulpecula). Mol Cell Endocrinol., 192: 115-126. GALLOWAY, S.M., McNATTY, K.P., CAMBRIDGE, L.M., LAITINEN, M.P., JENNIFER, S., JOKIRANTA, R.J., MCLAREN, K., LUIRO, K.G., DODDS, G.W.,

MOLECULAR MARKERS IN BMP15 GENE OF SHEEP

MONTGOMERY, J.L., BEATTIE, A.E., DAVIS, G.H. AND RITVOS, O., 2000. Mutations in an oocytederived growth factor gene BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet., 25: 279-283. GLISTER, C., KEMP, C.F. AND KNIGHT, P.G., 2004. Bone morphogenetic protein (BMP) ligands and receptors in bovine ovarian follicle cells: actions of BMP-4, -6 and 7 on granulosa cells and differentia modulation of Smad-1 phosphorylation by follistatin. Reproduction, 127: 239-254. HALL, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser., 41: 95-98. JUENGEL, J.L., HUDSON, N.L., HEATH, D.A., SMITH, P., READER, K.L., LAWRENCE, S.B., O’CONNELL, A.R., LAITINEN, M.P., CRANFIELD, M., GROOME, N.P., RITVOS, O. AND McNATTY, K.P. 2002. Growth differentiation factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular development in sheep. Biol. Reprod., 67:1777-1789. McNATTY, K.P., JUENGEL, J.L., READER, K.L., LUN, S., MYLLYMAA, S., LAWRENCE, S.B., WESTERN, A., MEERASAHIB, M.F., MOTTERSHEAD, D.G., GROOME, N.P., RITVOS, O. AND LAITINEN, M.P. 2005. Bone morphogenetic protein 15 and growth differentiation factor 9 cooperate to regulate granulosa cell function. Reproduction, 129:473-480. MORRIS, C.A., 1990. Theoretical and realized responses to selection for reproductive rate. Proc. 4th World Congress on Genetics Applied to Livestock Production

1357

Edinburgh, 16: 309. PENNETIER, S., UZBEKOVA, S., PERREAU, C., PAPILLIER, P., MERMILLOD, P. AND DALBIESTRAN, R. 2004. Spatiotemporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15, and VASA in adult bovine tissues, oocytes, and preimplantation embryos. Biol. Reprod., 71:1359-1366. RAFIQ, S. AND MUNIR, M., 1983. Sheep and goats: practices and potentials in Balochistan. Part: IV (chaghi and Kharan District) Arid Zone Res. Inst. Pakistan Agriculture research Council, Quetta Pakistan. SAMBROOK, J. AND RUSSEL, D.W., 2001. Molecular cloning: A laboratory mannual, 3rd ed. Cold spring harbor laboratory press, New York, USA. SOUZA, C.J., CAMPBELL, B.K., McNEILLY, A.S. AND BAIRD, D.T. 2002. Effect of bone morphogenetic protein 2 (BMP2) on oestradiol and inhibin A production by sheep granulosa cells, and localization of BMP receptors in the ovary by immune histochemistry. Reproduction, 123:363-369. WILSON, T., WU, X.Y., JUENGEL, J.L., ROSS, I.K., LUMSDEN, J.M., LORD, E.A., DODDS, K.G., WALLING, G.A., McEWAN, J.C., O'CONNELL, A.R., McNATTY, K.P. AND MONTGOMERY., G.W. 2001. Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein IB receptor (ALK-6) that is expressed in both oocytes and granulosa cells. Biol. Reprod., 64:1225-1235. (Received 4 July 2013, revised 21 September 2013)

Ó The American Genetic Association. 2011. All rights reserved. For permissions, please email: [email protected].

Journal of Heredity 2011:102(6):697–704 doi:10.1093/jhered/esr101

SAMUEL REZENDE PAIVA, ARTHUR

DA

SILVA MARIANTE,

AND

HARVEY D. BLACKBURN

From the EMBRAPA Recursos Gene´ticos e Biotecnologia (Embrapa Genetic Resources and Biotechnology), Laborato´rio de Gene´tica Animal, Parque Estacxa˜o Biolo´gica, Brası´lia, DF 70770-917, Brazil (Paiva and Mariante); and the National Animal Germplasm Program, National Center for Genetic Resources Preservation, Agricultural Research Service, United States Department of Agriculture, Fort Collins, CO (Blackburn). Address correspondence to Samuel R. Paiva at the address above, or e-mail: [email protected].

Abstract Microsatellites are commonly used to understand genetic diversity among livestock populations. Nevertheless, most studies have involved the processing of samples in one laboratory or with common standards across laboratories. Our objective was to identify an approach to facilitate the merger of microsatellite data for cross-country comparison of genetic resources when samples were not evaluated in a single laboratory. Eleven microsatellites were included in the analysis of 13 US and 9 Brazilian sheep breeds (N 5 706). A Bayesian approach was selected and evaluated with and without a shared set of samples analyzed by each country. All markers had a posterior probability of greater than 0.5, which was higher than predicted as reasonable by the software used. Sensitivity analysis indicated no difference between results with or without shared samples. Cluster analysis showed breeds to be partitioned by functional groups of hair, meat, or wool types (K 5 7 and 12 of STRUCTURE). Cross-country comparison of hair breeds indicated substantial genetic distances and within breed variability. The selected approach can facilitate the merger and analysis of microsatellite data for cross-country comparison and extend the utility of previously collected molecular markers. In addition, the result of this type of analysis can be used in new and existing conservation programs. Key words: genetic structure, merging data sets, molecular markers

Originally, all domestic sheep were imported to the Western Hemisphere (WH; Dohner 2001). As a result of these importations, there are issues impacting our understanding of these genetic resources including the similarity of WH breeds with a similar country of origin, and how divergent populations may have become since importation. Also, confounding the evaluations are WH sheep populations that share phenotypic similarities but are known by different names. The proposal for collection and use of a common set of genetic markers for the purpose of understanding genetic diversity was suggested by Barker et al. (1993). As a result, Food and Agriculture Organization (FAO) and the

International Society proposed a common set of microsatellite markers for Animal Genetics (Hoffmann et al. 2004). Despite the FAO recommendation, the merger of data sets from different countries has been limited (Baumung et al. 2004; Freeman et al. 2006; SanCristobal et al. 2006; Boitard et al. 2010), and to our knowledge, no sheep data sets have been merged. While these previous efforts made cross-country comparisons, the methodology used was not fully detailed, and there appeared to be opportunities for improvement, such as analysis of samples that were not genotyped in the same laboratory and utilization of allele frequency as a basis for comparison.

697

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

Combining US and Brazilian Microsatellite Data for a Meta-Analysis of Sheep (Ovis aries) Breed Diversity: Facilitating the FAO Global Plan of Action for Conserving Animal Genetic Resources

Journal of Heredity 2011:102(6)

698

Materials and Methods Microsatellite Data Sets US samples were derived from 28 breeds (N 5 674) and genotyped with 28 FAO loci (Blackburn et al. 2011), and Brazil (BZ) data had 10 breeds (N 5 383) and genotyped by 22 Loci (11 from the FAO panel) (Paiva et al. 2006), the subset of breeds used in this study are provided in Supplementary Material 1. Both countries data sets were obtained independently by different genotyping platforms with exception of 23 samples from the Brazilian Hampshire that were genotyped by both countries. For the US samples, a commercial company (GeneSeek) constructed the multiplex system, amplified the DNA, and made the allele calls (Blackburn et al. 2011). Paiva et al. (2006) detailed the collection and genotyping of the Brazilian samples, briefly, genotypes were obtained by capillary electrophoresis on an ABI310 Genetic analyzer (Applied Biosystems, Carlsbad, CA), and genotypes and allele calling were obtained using Gene Scan and Genotyper softwares (Applied Biosystems). It is important to note that Brazil had imported Hampshire in the 1990s from Canada and United States. Eleven markers were common for the US-BZ data set (HUJ616, ILSTS11, ILSTS5, INRA63, MAF214, MAF65, OarAE129, OarFCB20, OarFCB304, OarJMP29, and SRCRSP5) and were used for merging and genetic evaluation. Merging Procedure Two software packages were evaluated. The first approach COMBI.PL (Ta¨ubert and Bradley 2008) attempts to merge data sets by assigning allele sizes across studies using maximum likelihood estimation. The second, MicroMerge v.2 (Presson et al. 2008), is based on a Bayesian approach and aligns data sets marker by marker, matching each marker’s allele frequencies while preserving size order. Based on the assumptions of both approaches and the structure of the data set, we selected the Bayesian approach contained in MicroMerge v.2. MicroMerge matches allele frequencies between data sets rather than utilizing allele size. This software was run using the following options: the oneto-one alignment format, remerging markers with low posterior probabilities, adjusting the prior on the theoretical allele number, and the genotype error were set from default value (0.02) for the value of 0.06. In addition, alleles with only 1 or 2 reads within a country’s data set were deleted. The analysis was accomplished with a burn-in of 5000 iterations and 1 000 000–5 000 000 iterations during the actual merging of data (methods of MCMC). The criterion for acceptance of convergence for the posterior probabilities was considered at 0.6. This value was higher than the MicroMerge default of 0.45. Population Genetics Analyses The merged data set consisted of 38 breeds and 1057 animals with genotypes for all 11 selected markers. However, for the purpose of comparison among the countries, a smaller data set for the genetic analyses was

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

Assessment of genetic differences between livestock populations with microsatellites has provided important information on domestication, breed development, and current breed differences across geographic regions (Bruford et al. 2003; Hanotte 2007). In most of these instances, samples were acquired and analyzed in one laboratory or were used with a class of markers that have a genetic characteristic that permit a straightforward combination (e.g., sequence data). In order to improve the conservation of animal genetics resources, the global community has approved and published a Global Plan of Action for Animal Genetic Resources through FAO (2007). The Global Plan of Action articulated strategic priority for characterization of genetics resources in a way to optimize the cross-national comparability of data in order to monitor trends and risks to animal genetic resources at regional and global levels (FAO 2007). To date, some of the issues surrounding the merger of data sets from different laboratories/teams include the utilization of different analytical platforms, genotyping (binning) methods, and size standards to estimate allele calls. Some laboratories with formal linkages make use of control samples to validate data sets. However, such associations exclude the growing number of laboratories performing molecular genetic analysis across a variety of platforms. In addition, much of the validation of data sets is based on base-pair size matching criterion alone (Amos et al. 2007; Morin et al. 2009). Appropriate tools to accomplish the merging task with sufficient accuracy and precision to enable robust conclusions are needed. There are some approaches that have been proposed to accomplish the task of merging microsatellite data (Freeman et al. 2006; Presson et al. 2006, 2008). The Presson et al. (2006, 2008) approach, which we ultimately used, consists of a Bayesian model and Markov chain Monte Carlo (MCMC) algorithm for sampling the posterior distribution under the conditions of the model. An output and measure of how successfully 2 independent measures of the same locus have been merged is the resultant posterior probability. That is, the posterior probability provides insight as to the confidence in the merged data, which the user can determine if the merged results are acceptable. To date, such an approach has not been fully utilized in livestock genetic diversity studies but is needed given the variety of laboratories that have collected microsatellite data and wish to make full use of this type of data. The national animal genetics resources conservation programs in Brazil and in the United States wanted to determine the similarities and differences in a number of their sheep populations. Both countries have collected substantial numbers of animals and breeds for independent analysis of within country genetic diversity (Paiva et al. 2006; Blackburn et al. 2011). It is of benefit for both countries to merge this data and evaluate genetic differences or similarities that may exist. Therefore, the objectives were to test the utility of merging microsatellite data sets for a meta-analysis of genetic diversity found across the 2 countries.

Paiva et al.  Meta-Analysis of Microsatellite Data from US and Brazil Sheep (Ovis aries) Breeds

Results Based on the preset convergence criteria, the Bayesian methodology for merging the 2 data sets was successful and appeared robust. For these data sets, posterior probabilities of each locus ranged from 0.6 to 1.0 and from 0.5 to 0.98 with and without the shared samples (Table 1). The result of comparing with and without common markers was anticipated; however, the level of agreement was unexpected. The majority of articles for livestock diversity studies there are no common samples. For this reason and to test the robustness of MicroMerge, the 2 markers with posterior probabilities of less than 0.6 (HUJ616 and OarAE129) were discarded, and intra- and intergenetic diversity indices were performed. Within diversity indices between the 2 panels (11 and 9 markers) were very similar (data not shown), and the Mantel test for Nei genetic distances matrices between breeds showed a correlation coefficient of 0.92 (P , 0.000001) for the 2 panels,

Table 1 Merging results of 11 common microsatellite obtained from 2 independent sheep data sets genotyped by United States and Brazil Alleles

Posterior probabilities

Loci

US

BZ

Final

With shared samples

Without shared samples

HUJ616 ILSTS11 ILSTS5 INRA63 MAF214 MAF65 OarAE129 OarFCB20 OarFCB304 OarJMP29 SRCRSP5

23 9 12 21 10 11 9 15 22 20 6

9 8 9 12 9 10 8 14 16 17 5

10 10 11 14 8 10 5 13 15 15 6

0.867 0.730 0.970 0.810 0.924 0.827 1.000 0.790 0.614 0.784 1.000

0.503 0.681 0.943 0.679 0.983 0.925 0.517 0.606 0.684 0.645 0.977

Posterior probability provides insight as to the confidence in the merged data, which the user can determine if the merged results are acceptable.

suggesting that merging could proceed with a relatively small number of microsatellite markers within the predefined convergence criteria. The number of alleles observed in US breeds was always higher than the Brazilian breeds probably because of the number of breeds and larger sample sizes. After the merging procedure, the number of alleles for the unified matrix of genotypes, as expected, had the tendency to be reduced, except for the markers ILSTS11 and SRCRSP5. The within genetic diversity among breeds showed that both countries had similar ranges for mean number of alleles and He (expected heterozygosis); however, Brazilian breeds had high levels of Ho (observed heterozygosis) (Table 2). Inbreeding (FIS) was lowest for the collection of Brazilian breeds, whereas values for some US populations were significantly larger (Table 2). The hair and hair-coarse wooled sheep breeds tended to have higher levels of genetic diversity than wooled breeds, except for Rambouillet and Navajo Churro. The DK peaked at K 5 2 and had a minor peak at K 5 12 suggesting structural differences for these populations (Evanno et al. 2005). Based on the DKs, knowledge of breed histories, and inspection of the range of Ks tested, the K values of 2, 7, and 12 were evaluated. When K 5 2, the Brazilian Hampshire and Ile de France were placed in the same cluster as all US breeds (Figure 1). This placement suggests that the merging process was successful because both breeds genetic backgrounds/formation involve the same breeds as those found in the US breeds. When K 5 7, it was found that breeds were classified by their commercial function or major phenotype class (e.g., long wool, hair, black face, and meta production) and not just by their country of origin. The K value of 12 showed a more refined substructure of the pattern identified with K 5 7. Of particular interest was the placement of the US and BZ Hampshires and the Dorpers. As expected Hampshires were placed in the same cluster, but unexpectedly, the

699

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

selected and comprised of 21 breeds, 12 from United States, and 9 from Brazil (N 5 706). The data set was reduced to eliminate many of the US breeds that are composite populations. The first hypothesis tested with the consolidated data set was to verify the level of genetic structure from both countries analyzed by Structure software (Pritchard et al. 2000). With this software, the individuals were probabilistically assigned using Bayesian inference to determined populations or grouped to one or more populations. For these estimates, the methods of MCMC were used, calculating for each individual the probability of one specific genotype ‘‘X’’ to be part of one given population ‘‘K’’ as the natural logarithm: [ln Pr (X|K)]. Those probabilities for K varied from 1 to 21 and were estimated by averaging the results of 3 replicate runs each having 650 000 iterations (MCMC) with an initial burn-in value of 200 000. The repetitions for each K were used to estimate an ad hoc indicator of population number based in the averaged likelihood at each K, called DK (Evanno et al. 2005). Cluster assignments and their graphical representation were performed using DISTRUCT (Rosenberg 2004). A second hypothesis analyzed by structure was verifying the power of microsatellite markers to identify common origins among hair sheep breeds presented in both countries. To corroborate Structure results, principal coordinate analysis was performed with Nei’s Genetic distance (Nei 1972), and estimates between populations were computed with GENALEX 6 software (Peakall and Smouse 2006). Analysis of molecular variance (AMOVA) was performed with Arlequin software (Excoffier and Lischer 2010) using the codominant allelic distance matrix with 1000 permutations, as an additional test to identify traces of genetic structure in a series of contrasts between all populations studied. Fixation index (FIS) and basic within genetic diversity coefficients were calculated using FSTAT (Goudet 2002) and Molkin (Gutie´rrez et al. 2005).

Journal of Heredity 2011:102(6) Table 2 Genetic diversity measures by breed (N, number of samples; AM, mean number of alleles; AE, effective number of alleles; He, expected heterozygosis; Ho, observed heterozygosis; MolC, mean molecular coancestry index; and FIS, inbreeding coefficient) Code

N

AM

AE

He

Ho

MolC

Barbados Blackbelly Dorper Gulf Coast Native Hampshire-BZ Hampshire Karakul Leicester Longwool Lincoln Navajo Churro Rambouillet Saint Croix Suffolk Tunis Saint Ines Brazilian Bergamasca Brazilian Fat-Tail Morada Nova Brazilian Somali Ile de France Damara Dorper-BZ

BBL DOR GCN BzHAM HAM KAK LEL LIN NVC RAM SCX SUF TUN OSI BzBER BzFAT OMN BzSOM ILE ODA BzDOR

18 44 30 23 29 19 29 22 31 47 26 26 14 94 46 48 48 48 24 10 30

4.45 6.27 6.09 5.73 5.64 3.64 4.36 4.55 6.00 6.18 5.36 5.36 4.91 6.27 5.36 5.45 5.09 4.55 4.64 3.64 4.64

3.084 3.291 3.415 3.113 3.056 2.603 2.363 2.848 3.315 3.315 3.345 3.092 3.025 3.917 3.083 3.085 3.365 2.601 3.060 2.749 2.919

0.6536 0.6463 0.6858 0.6118 0.5851 0.5766 0.5282 0.5967 0.6744 0.6871 0.6780 0.6348 0.6320 0.7292 0.6531 0.6600 0.6798 0.5504 0.6060 0.6689 0.6300

0.4958 0.4814 0.5543 0.5217 0.5235 0.3930 0.3976 0.4493 0.4982 0.5488 0.5863 0.5038 0.5100 0.6882 0.6842 0.7014 0.6225 0.6570 0.5534 0.7264 0.6393

0.3723 0.3929 0.3631 0.3266 0.3174 0.3709 0.2946 0.3484 0.4004 0.4045 0.3637 0.3532 0.3449 0.3741 0.3092 0.2938 0.3584 0.2158 0.3144 0.2452 0.3019

FIS 0.248* 0.258* 0.196* 0.151 0.107 0.326* 0.254* 0.252* 0.265* 0.203* 0.138 0.210* 0.200 0.056 0.048 0.063 0.085 0.196 0.089 0.107 0.015

*Significative homozygous excess after Bonferroni correction P , 0.00018.

Dorpers were not. Although sampling could explain the difference, the Hampshire results would indicate that this is not an explanation. An alternative hypothesis is that the Dorper, a composite (Dorset  Blackhead Persian) formed during the 1940s (Porter and Mason 2002), still has not stabilized sufficiently to breed true. Alternatively, the US Dorper sample had a higher FIS value, which could contribute to the separation between the Brazilian and US populations (Table 2). A series of AMOVA were performed using 4 different contrasts (Table 3). In general, the principal contrast observed (last one) showed 12.84% (P , 0.01) of observed variation, which was explained by differences between breeds that are similar to other literature values (Handley et al. 2007). The other contrasts tested were not significant. Principal coordinate analysis was performed, and the first 3 components accounted for 65% of the observed variation (Figure 2). It was expected that the hair breeds for both countries would be similar. However, neither the Structure nor principal component analysis supported this assumption. The principal component analysis also indicated that there was substantial variability among the Brazilian hair sheep populations. Of particular interests are: 1) the divergence between the BZ Somali, BZ Dorper, and US Dorper and 2) the proximity of Barbados Blackbelly to the Brazilian hair sheep breeds by the 2 first principal components provides some insight as to the Barbados Blackbelly relationship to other breeds. The principal component analysis also showed the Somali and Brazilian Dorper to be outliers. Given the Somali’s use in developing the Dorper and the similar phenotypes across eastern and southern Africa, a closer association was anticipated.

700

Discussion The merging procedure made possible an evaluation of US and Brazilian sheep breeds. The close association and similar measures of genetic variability for the Hampshire populations suggest that the merging process was successful and that the differences in genetic variation and genetic similarity were a function of allele frequencies observed and not the merging process. The higher levels of inbreeding (FIS) observed in some US breeds could possibly be due to smaller population sizes or a higher level of selection pressure. Across all analysis of AMOVA performed the within populations was the largest and most significant source of variation. These results are similar to a wide range of studies (Handley et al. 2007; Peter et al. 2007; Blackburn et al. 2011). Among populations, within groups were also a significant source of variation, although substantially smaller than the within population component. This result suggests that breeds within countries (e.g., hair vs. wool breeds and even rare breeds within country) exhibited distinct genetic variation useful in utilizing these genetic resources as breeders strive to increase productivity and the breeds’ competitive advantage. Several conclusions can be derived when following the STRUCTURE analysis for 2, 7, and 12 clusters. From the perspective of the merging procedure when K equaled 2, the Brazilian Hampshire was placed within the US breeds as was a high proportion of the Ile de France. The similarities of Hampshire from both countries are likely explained by the importation of animals in the 1990s from Canada and United States (ABCOHD 2009) and their common UK origin. For breeds within country, there was agreement with

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

Breed

Paiva et al.  Meta-Analysis of Microsatellite Data from US and Brazil Sheep (Ovis aries) Breeds

previously published results about the association of breeds within a cluster (Paiva et al. 2006; Blackburn et al. 2011). For example: Barbados Blackbelly—Saint Croix, Damara—Brazilian Dorper, Hampshire—Brazilian Hampshire-Suffolk, and Morada Nova—Brazilian Fat-tail. In terms of using the merged data in a Bayesian and principal component analysis, it was possible to assess genetic variability between the 2 countries. When K was set to 7, breeds within country tended to be placed in clusters

based on function. Within the United States, these groups consisted of hair, fine wooled, long wooled, and meat breeds. In addition to the previously discussed associations between US and Brazilian breeds, multibreed Brazilian clusters consisted of Santa Ines, Bergamasca, Morada Nova, and Brazilian Fat-tail. The Damara, Brazilian Dorper, and Brazilian Somali were in separate clusters. It was noted that the Ile de France a composite of Leicester Longwool and Merino (Porter and Mason 2002) was admixed with cluster

Table 3 AMOVA obtained among US and Brazil sheep breeds by a set of 11 microsatellite markers Sample contrast

Source of variation

df

Sum of squares

Percentage variation

United States versus Brazil

Among groups Among populations within groups Within populations Among groups Among populations within groups Within populations Among groups Among populations within groups Within populations Among populations Within populations

1 23 1531 1 23 1531 1 9 833 24 1531

53.172 596.790 4125.672 56.684 593.278 4125.672 51.192 262.412 2377.139 649.962 4125.672

0.78ns 12.38* 86.84* 0.96ns 12.27* 86.76* 1.81ns 10.84* 87.35* 12.84* 87.16*

Wool versus hair breeds US versus Brazil rare breeds Between breeds

df, deghrees of freedom; ns, non significative. *Significative P , 0.01.

701

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

Figure 1. Genetic structure of US and Brazilian (BZ) sheep breeds by Bayesian analysis with 11 microsatellite loci. K 5 number of clusters (for breed codes, Table 2).

Journal of Heredity 2011:102(6)

assignments corresponding to the Leicester Longwool and the Rambouillet. The evaluation of breeds when K 5 12, which the approach of Evanno et al. (2005) indicated was an appropriate number of clusters for this set of breeds and yielded a number of insights about the breeds and their relationship to one another. Among the Brazilian breeds, the Bergamasca, Brazilian Fat-tail—Morada Nova, Brazilian Somali, Ile de France, and Damara—Brazilian Dorper formed unique clusters. Although the Santa Ines was placed in a separate cluster and shown to have a substantial amount of admixture (in part due to its formation with Bergamasca and Brazilian Fat-tail). The Brazilian Fat-tail and Morada Nova were also shown to have a substantial proportion of their genetic composition in the Santa Ines cluster. Across countries, both Hampshire populations were placed in the same cluster corroborating the previous K values and recent importations. The association among the hair breeds of the 2 countries is of interest due to a growing attention in the production of sheep with little or no wool. Using principal component analysis (Figure 2) showed the hair breeds widely dispersed across the 3 dimensions. The Brazilian Dorper and Brazilian Somali were placed at the extreme corners of the first and second principal components, whereas the Barbados Blackbelly and Morada Nova were placed at the extremes of the third principal component. Breeds placed in closest proximity to one another were the Barbados Blackbelly—Brazilian Fat-tail and the Santa Ines—Morada Nova. The relatively close association between the Barbados Blackbelly and the Brazilian Fat-tail is the first close association seen with the Barbados Blackbelly. However, the origin of the Brazilian Fat-tail is not clearly known. Muigai

702

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

Figure 2. Relative placement of hair sheep breeds using principal coordinate analysis obtained by Nei unbiased genetic distance. BBB, Barbados Blackbelly; STC, Saint Croix; DOR, Dorper; STI, Saint Ines; BzFAT, Brazilian Fat Tail; MN, Morada Nova; BzSOM, Brazilian Somali; and BzDOR, Brazilian Dorper.

et al. (2002) reported the Barbados Blackbelly to be more closely associated with Iberian wooled breeds instead of West African hair breeds, thereby rejecting their original hypothesis. The Brazilian and US Dorpers were not closely associated in the STRUCTURE or principal component analyses; in addition, the Brazilian Somali was quite distinct from the 2 Dorper populations. The difference among Dorper populations was also observed by Kijas et al. (2009), suggesting that distinct subpopulations were exported, or gene frequencies have not been sufficiently fixed within South Africa. Presently, there is little overlap between Brazilian and US sheep breeds. The distinctness of both countries hair, meat, fine wool, and long wool populations indicate a wide range of genetic variability has been transferred to the WH. These results would suggest that WH sheep breeders have an opportunity to evaluate each other’s populations and determine if their respective breeds might benefit from the introgression of genes that would yield significant levels of heterosis for production traits of interest. In addition, these results would suggest that among the WH, these 2 countries have established sheep populations with considerable variability important for conservation. The present study was the first to apply for livestock the proposed method by Presson et al. (2008), which was developed for humans. The results appear robust enough to support the merging of microsatellite data for other livestock species. The higher posterior probabilities obtained for most of the markers showed the importance to have common animals (breed Hampshire) genotyped in both analyses (Table 1). Because of the complexity of electrophoresis and the variability of analytical platforms, the simple comparison based on base-pair size as a matching criterion alone can increase the probability of errors in the merging process. The Bayesian approach appears to enhance the matches between allele frequencies for these 2 data sets and therefore circumvent the issues created by merging based on allele size. It was found that alleles with low frequencies were more difficult to estimate a posterior probability greater than the cutoff level of 0.6. However, this problem will likely remain an issue regardless of the approach used to merge data sets, thus requiring careful evaluation of potential reasons for the alleles to have a low frequency (e.g., genotyping errors). Furthermore, potential exclusion of alleles with very low frequencies may not have a large impact on cross-country evaluations given the results from STRUCTURE when K 5 2. The robustness of the adapted method was observed when the results obtained with 11 markers (common samples) and 9 markers (without common samples) did not vary significantly. In addition, Presson et al. (2008) suggested a default threshold of 0.425 to discard a marker; however, in this study, the threshold was increased to 0.6 for data sets with common samples, in order to obtain a more conservative evaluation. Freeman et al. (2006) proposed a regression method that a simple presence of a common breed is enough to support necessary information to merge the results between 2 or more data sets. The results of this study were in agreement because the presence of Hampshire

Paiva et al.  Meta-Analysis of Microsatellite Data from US and Brazil Sheep (Ovis aries) Breeds

Supplementary Material Supplementary material can be found at http://www.jhered. oxfordjournals.org/.

Funding

Barker JSF, Bradley DG, Fries R, Hill WG, Nei M, Wayne RK. 1993. An integrated global programme to establish the genetic relationships among the breeds of each domestic animal species. Rome (Italy): FAO. Report of a working group for the Animal Production and Health Division. Baumung R, Simianer H, Hoffmann I. 2004. Genetic diversity studies in farm animals—a survey. J Anim Breed Genet. 121:361–373. Blackburn HD, Paiva SR, Wildeus S, Getz W, Waldron D, Stobart R, Bixby D, Purdy PH, Welsh C, Spiller S. 2011. Genetic structure and diversity among US sheep breeds: identification of the major gene pools. J Anim Sci. 89:2336–2348. Boitard S, Chevalet C, Mercat MJ, Meriaux JC, Sanchez A, Tibau J, Sancristobal M. 2010. Genetic variability, structure and assignment of Spanish and French pig populations based on a large sampling. Anim Genet. 41:608–618. Bruford MW, Bradley DG, Luikart G. 2003. DNA markers reveal the complexity of livestock domestication. Nat Rev Genet. 4:900–910. Dohner JV. 2001. The encyclopedia of historic and endangered livestock and poultry breeds. New Haven (CT): Yale University Press. Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 14:2611–2620. Excoffier L, Lischer HEL. 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 10:564–567. FAO. 2007. The Global Plan of Action for Animal Genetic Resources and the Interlaken Declaration. Rome (Italy): FAO; [cited 2011 Mar] Available from: ftp://ftp.fao.org/docrep/fao/010/a1404e/a1404e00.pdf. Freeman AR, Bradley DG, Nagda S, Gibson JP, Hanotte O. 2006. Combination of multiple microsatellite data sets to investigate genetic diversity and admixture of domestic cattle. Anim Genet. 37:1–9. Goudet J. 2002. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9. 3.2). Lausanne (Switzerland): University of Lausanne, Department of Ecology and Evolution. Gutie´rrez JP, Royo LJ, Alvarez I, Goyache F. 2005. MolKin v2.0: a computer program for genetic analysis of populations using molecular coancestry information. J Hered. 96:718–721.

ARS/USDA, CNPq and Embrapa.

Handley LJL, Byrne K, Santucci F, Townsend S, Taylor M, Bruford MW, Hewitt GM. 2007. Genetic structure of European sheep breeds. Heredity. 99:620–631.

Acknowledgments

Hanotte OH. 2007. Origin and history of livestock diversity. In: Richkowsky B, Pilling D, editors. The state of the world’s animal genetic resources for food and agriculture. Rome (Italy): FAO. p. 5–19.

The authors thank the owners of the numerous flocks that provided tissue samples for this project. Mention of a trade name or proprietary product does not constitute a guaranty or warranty by the United States Department of Agriculture (USDA) and Embrapa and does not imply approval to the exclusion of other products that may be suitable. In addition, the authors would like to thank the 2 anonymous reviewers. USDA, Agricultural Research Service, and Northern Plains Area are an equal opportunity/ affirmative action employer. All agency services are available without discrimination.

References

Hoffmann I, Marsan PA, Barker JSF, Cothran EG, Hanotte O, Lenstra JA, Milan D, Weigend S, Simianer H. 2004. New MoDAD marker sets to be used in diversity studies for the major farm animal species: recommendations of a joint ISAG/FAO working group. Proceedings of the 29th International Conference on Animal Genetics, 2004 Sep 11–16; Tokyo, Japan 123 [Abstract]. Kijas JW, Townley D, Dalrymple BP, Heaton MP, Maddox JF, McGrath A, Wilson P, Ingersoll RG, McCulloch R, McWilliam S, et al. 2009. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds. PLoS One. 4:e4668.

Amos W, Hoffman JI, Frodsham A, Zhang L, Best S, Hill AVS. 2007. Automated binning of microsatellite alleles: problems and solutions. Mol Ecol Notes. 7:10–14.

Morin PA, Manaster C, Mesnick SL, Holland R. 2009. Normalization and binning of historical and multi-source microsatellite data: overcoming the problems of allele size shift with allelogram. Mol Ecol Resour. 9:1451–1455.

Associac xa˜o Brasileira de Criadores de Ovinos Hampshire Down (ABCOHD). 2009. Hampshire no Brasil. Brazilian Association of Hampshire Down Breeders; [cited 2011 Apr 25]. Available form: http:// hampshire.com.br/?pg5brasil.

Muigai AWT, Hirbo J, Sharkey S, Rege JEO , Blackburn H, Hanotte O. 2002. Genetic diversity and relationships of hair sheep breeds of the Americas: first results. Proceedings of the 7th World Congress on Genetics Applied to Livetock Production; Montpellier, France p. 573–576.

703

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

breed in both data sets helps the merging process and we had better results (higher posterior probabilities for each locus) when the common samples were used, illustrating the desirability of having common samples whenever possible. However, as the posterior probabilities illustrate, the MicroMerge approach does offer researchers an opportunity to explore combining data sets with no genotyping of common animals/breeds. In conclusion, it is suggested that the method evaluated can be used to successfully merge livestock data sets. Application of the approach permitted an evaluation of genetic diversity among US and Brazilian sheep breeds. As a result, both national programs are in a better position to assess their national sheep populations and plan in situ and ex situ conservation activities. Based on these results, it was also suggested that the tested approach can be further utilized to make cross-country or region comparisons for livestock populations in general. Such evaluations are timely as many countries and laboratories within countries have expended considerable resources in collecting and genotyping livestock populations via microsatellites markers and have not yet made full use of their investment. Furthermore, as genotyping platforms are converting from microsatellites to SNPs and whole-genome analysis, such evaluations may bring microsatellite analysis to a logical conclusion.

Journal of Heredity 2011:102(6) Nei M. 1972. Genetic distance between populations. Am Nat. 106: 283–292.

to combine genotype data for linkage and association analysis. BMC Bioinformatics. 9:317.

Paiva SP, Faria DF, Dergam JD, McManus CM, Guimara˜es SG, Egito AE, Albuquerque MA, Silvia SC, Mariante AS. 2006. Genetic structure of hair sheep breeds in Brazil by microsatellites markers. Proceedings of the 30th International Conference on Animal Genetics; 2006 Aug 20–25; Porto Seguro, Brazil. Belo Horizonte (Brazil): CBRA, section A [Abstract].

Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics. 155:945–959.

Peakall ROD, Smouse PE. 2006. GENALEX 6: genetic analysis in excel. Population genetic software for teaching and research. Mol Ecol Notes. 6:288–295.

SanCristobal M, Chevalet C, Haley CS, Joosten R, Rattink AP, Harlizius B, Groenen MA, Amigues Y, Boscher MY, Russell G, et al. 2006. Genetic diversity within and between European pig breeds using microsatellite markers. Anim Genet. 37:189–198.

Peter C, Bruford M, Perez T, Dalamitra S, Hewitt G, Erhardt G. 2007. Genetic diversity and subdivision of 57 European and Middle-Eastern sheep breeds. Anim Genet. 38:37–44. Porter V, Mason IL. 2002. Mason’s world dictionary of livestock breeds, types, and varieties. New York: CABI.

Rosenberg NAR. 2004. DISTRUCT: a program for the graphical display of population structure. Mol Ecol Notes. 4:137–138.

Ta¨ubert H, Bradley DG. 2008. COMBI. PL: a computer program to combine data sets with inconsistent microsatellite marker allele size information. Mol Ecol Resour. 8:572–574.

Received April 26, 2011; Revised August 23, 2011; Accepted August 30, 2011

Presson AP, Sobel EM, Pajukanta P, Plaisier C, Weeks DE, Aberg K, Papp JC. 2008. Merging microsatellite data: enhanced methodology and software

Corresponding Editor: Ernest Bailey

704

Downloaded from http://jhered.oxfordjournals.org/ at Gadjah Mada University on April 15, 2014

Presson AP, Sobel E, Lange K, Papp J. 2006. Merging microsatellite data. J Comput Biol. 13:1131–1147.

African Journal of Biotechnology Vol. 11(90), pp. 15617-15625, 8 November, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.2275 ISSN 1684–5315 ©2012 Academic Journals

Review

Molecular markers for genetic diversity and phylogeny research of Brazilian sheep breeds Bruno do Amaral Crispim1*, Márcia Cristina Matos2, Leonardo de Oliveira Seno3 and Alexéia Barufatti Grisolia1 1

Faculdade de Ciências Biológicas e Ambientais, Universidade Federal da Grande Dourados – Dourados/MS, Brazil. 2 Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista – Jaboticabal/SP, Brazil. 3 Faculdade de Ciências Agrárias, Universidade Federal da Grande Dourados – Dourados/MS, Brazil. Accepted 2 October, 2012

Brazilian sheep descended from several breeds brought to the New World by Portuguese and Spanish colonists, and they have evolved and adapted to local climatic variations and acquired tolerance or resistance to many diseases. Molecular markers are widely used in analyzing genetic variability, and markers such as amplified fragment length polymorphism (AFLP), restriction fragment length polymorphism (RFLP), microsatellite, mtDNA and single nucleotide polymorphism (SNP) have facilitated the characterization of genetic diversity and population structure, and in the investigation of the natural history, behavior, and evolution of several sheep breeds. In this context, we present here a review of the uses of molecular markers in ecological and conservation research of Brazilian sheep breeds. Key words: DNA polymorphism, genetic conservation, Ovis aries.

INTRODUCTION Brazilian sheep originated from Portuguese and Spanish breeds that were introduced into the New World by colonists. Over the years, these breeds were subjected to natural selection of local environmental and edaphoclimatic conditions, resulting in breeds that are currently considered naturalized, locally adapted, or native (Mariante et al., 1999). Agricultural census data collected by the Brazilian Institute of Geography and Statistics put the Brazilian sheep population at more than 17 million animals, center mainly in the southern and northeastern regions of the country. Ovinoculture constitutes a sound economic option due to demands for meat (Aro et al., 2007). Naturalized

*Corresponding author. E-mail: [email protected]. Abbreviations: SNP, single nucleotide polymorphism; PCR, polymerase chain reaction; AFLP, amplified fragment length polymorphism; PCR/RFLP, restriction fragment length polymorphism-polymerase chain reaction; RAPD, random amplified polymorphic DNA; STR, simple sequence repeats; SRY, sex-determining region Y; COI, cytochrome oxidase I.

breeds are often preferred due to their rustic characteristics and adaptability in tropical and subtropical climates, giving these breeds important attributes and offering future genetic resources. The naturalized Brazilian breeds are usually small animals that have been subjected to only weak levels of artificial selection and sustainable genetic improvement, and they are little specialized for intensive milk and/or meat production (Paiva et al., 2005a). The general traits of well-known naturalized breeds in Brazil are described in Table 1. The survival and preservation of naturalized breeds with important genetic heritages were threatened during the 20th century, by indiscriminate crossbreeding with exotic breeds (mainly from Africa and Europe) (Morais, 2001). It should be noted that these naturalized animals have many adaptive traits that make them useful for breeding and production, such as: tolerance or resistance to diseases and parasites, and extensive adaptations related to the availability and quality of food resources and water – as the animals that were better adapted and/or more resistant survived and reproduced. Naturalized breeds therefore represent the results of

15618

Afr. J. Biotechnol.

Table 1. Origins, sites of occurrence, and phenotypic traits of naturalized Brazilian sheep breeds.

Breed

Origin

Site of occurrence

Crioula Lanada

Crossbreeding between local and exotic breeds: Spanish Lacha, Romney Marsh and Corriedale, as well as herds introduced by Portuguese colonizers

Rio Grande do Sul State; South America (from Peru to Uruguay)

Santa Inês

Crossbreeding between Bergamacia, Morada Nova and mixed races from Northeastern Brazil (possibly of African origin)

Phenotypic trait Face and extremities uncovered. Wool ranges from white to black, medium length, suitable for wool production; Resistant to endoparasites.

Reference Mariante et al., 2003; ARCO, 2011

Northeastern Brazil (Ceará, Maranhão, Sergipe, among other states)

Woolless, short hair, small animals. High quality meat with low fat content. Of economic importance due to their sizes and environment adaptations.

Mariante et al., 2003; Paiva, 2005a

Crossbreeding between African and Portuguese Bordaleiro

Northeastern Brazil (Ceará, Piauí, among other states)

Woolless; no horns; red, white or cream wool; with or without earrings. Suitable for meat production and high quality leather.

Oklahoma State University, 2007; ARCO, 2011

Brazilian Bergamacia

Originally from Italy

Northeastern Brazil (Bahia) and temperate climate states in the central-western region

Large size, white wool Rustic with multiple uses (meat, wool and milk)

ARCO, 2011

Brazilian Somalis

Somalia and Ethiopia

Northeastern Brazil (Ceará and Rio Grande do Norte states)

High fertility, fat rump, with some wool on the body, good meat and leather production

ARCO, 2011

Damara (Rabo Largo)

Northwestern Namibia and southern Angola*

Northeastern Brazil (arid regions)

Medium size, good meat and leather production ,woolless animals

ARCO, 2011

African origin

Northeastern Brazil and a conservation nucleus in Roraima State

High fertility and reproductively efficient, woolless animals

Oklahoma State University, 2007

Morada Nova

Black belly

*The hypothesis that Rabo Largo is derived from Damara was not confirmed by microsatellite marker analyses (Paiva et al., 2005a).

long-term natural selection processes. Conservation and genetic improvement programs focusing on naturalized animals are important to avoid both their inbreeding and indiscriminate crossbreeding, so that pure native breeds can be conserved. In this context, it would be necessary to design production systems that allow producers to use local breeds more efficiently for better financial returns (Notter, 1999). Research on the adaptive traits of different breeds are important for supporting livestock production systems based on native breeds, reducing environment impacts, and obtaining better products for commercial consumption. Recent technological developments and new molecular tools have dated researchers discovering the origins and domestication processes of a wide variety of species.

These tools have aided our understanding of the evolutionary relationships, taxonomies, and demographics of a wide variety of species and provided support for identifying priority areas for preservation programs and for analyzing genetic diversity in both domestic species and wild and endangered species (Rosa and Paiva, 2009; Grisolia and Moreno-Cotulio, 2012). Single nucleotide polymorphism (SNP) markers have begun to provide new perspectives for genomic studies, particularly in investigations of the diversities of the genomes of individuals and populations, in the search for genes that cause diseases, and in the identification of selection signatures (Kijas et al., 2012; Pariset et al., 2012). This review discusses the evolution of the use of molecular markers in analyzing the genetic diversity and

Crispim et al.

phylogeny of naturalized Brazilian sheep breeds. MOLECULAR MARKERS Molecular markers can be considered as any molecular phenotype derived from a specific DNA segment, and correspond to regions that are expressed (or not) in the genome (Ferreira and Grattaplaglia, 1996). Isozyme markers were initially developed, which are direct products of gene expression (Oliveira et al., 2002), but were followed by molecular markers that amplify DNA chains using polymerase chain reaction (PCR). Research focusing on patterns of genetic variation of certain loci markers within a population make it possible to minimize the impacts generated by crossbreeding between naturalized animals, ensuring the conservation of their genetic diversity. These studies provide information about loss of intra-population genetic variability as a consequence of reductions in the effective size of populations – leading to increases in consanguinity and genetic drift (Kantanen et al., 1999). The use of nuclear DNA molecular markers can increase the efficiency of genetic breeds programs through selection and by avoiding crossbreeding within the same generation (Melo et al., 2008). The polymorphic markers currently used in genetic diversity analyses are: amplified fragment length polymorphism (AFLP), restriction fragment length polymorphism-polymerase chain reaction (PCR/RFLP), random amplified polymorphic DNA (RAPD), microsatellites or simple sequence repeats (STR), sex-determining region Y (SRY) and SNP. The AFLP technique is based on PCR amplification of a subset of fragments obtained from the site-specific cleavage of genomic DNA by type II restriction enzymes (Lopes et al., 2002). This technique has been found to be efficient in studies of genetic diversity in sheep, such as those of Xiao et al. (2009) who analyzed this marker in six breeds of sheep in China. PCR/RFLP detects patterns of polymorphisms among different individuals and is based on the differences in the sizes of restriction fragments generated by endonuclease cleavage of amplified DNA regions. PCR-RFLP analysis of molecular markers in phylogenetically related species has been used to elucidate ambiguous taxonomic classifications. Paiva et al. (2005a), examining this marker in part of the cytochrome oxidase I (COI) mitochondrial gene (1052 base pairs fragment) was able to show that the main breeds of naturalized Brazilian sheep were of European origin (such as Santa Ines and Bergamacia), although other naturalized breeds (such as Somalis and Morada Nova) were of African origin. RAPD studies are based on polymerase chain reactions, using primers homologous to target sites in the genome. This marker aids in deciphering patterns of genetic variation and can be used to direct conservation measures for threatened or endangered species.

15619

Although there are many advantages to the use of this marker, there are also some disadvantages in terms of low reproducibility (Paiva et al., 2005b) and the formation of heteroduplex is a characteristic of dominance, but a number of researchers have demonstrated the efficiency of this technique in genetic diversity studies of sheep breeds in Pakistan (Qasim et al., 2011), Indian (Kumar et al., 2003), and Turkey (Elmaci, 2007). Another technique widely used for characterizing genetic variability, individual identifications, paternity testing, the construction of genetic maps, and studies of population genetics employs microsatellites. Microsatellites have high mutation rates, abundances, and distributions throughout the genome, and show neutrality and co-dominance, and the easy automation of analytical procedures allow their use in estimating genetic diversity between and within breeds (Ligda et al., 2009). Microsatellite markers show good reproducibility and high degrees of polymorphism (Cañon et al., 2000; Grisolia et al., 2007) and are widely used in characterizing the genetic diversity of sheep breeds (Ramey II et al., 2000; Arranz et al., 2001). SRY molecular markers are extremely sensitive probes of paternal inheritance and are used to elucidate genetic histories, the processes of breed domestication, population relationships, and male gene-flow. The use of SRY markers combined with the Y chromosome can provide specific details of the gene-flow in males. The numbers of research projects in sheep using the Y chromosome have been quite limited, however, when compared to other domestic animals such as cattle (Hanotte et al., 2000; Pérez-Pardal et al., 2009) and goats (Pidancier et al., 2006; Sechi et al., 2009). Only one microsatellite locus (SRYM18) and eight SNP, located in the region 5' of the promoter of the sexdetermining gene (SRY), have been identified in sheep (Meadows et al., 2006; Meadows and Kijas, 2009). SNP markers are based on elementary alterations in the DNA molecule, that is, mutations in single nucleotides (adenine, cytosine, thymine, or guanine), and are biallelic, that is, only two variants are generally found in a single species (such as an allele corresponding to the base pair A/T and the other to G/C). SNPs are extremely abundant in the genomes of non-endogamic species and can occur in coding regions or with regulatory functions – although, in most cases, they are found in intergenic spacer regions. Until recently, the standard techniques of prospecting for SNP markers were based on Sanger’s sequencing method, although second-generation sequencing technologies (Roche 454 - Margulies et al., 2005; Solexa-Illumina – Bennett, 2004; and ABI Solid Valouev et al., 2008) are now able to produce large data sets (on the order of millions of sequenced bases). As such, a number of molecular markers can be used to analyze genetic diversity, and while microsatellites have been widely employed (McManus et al., 2010; Paiva et al., 2011b; Souza et al., 2012), SNPs have been

15620

Afr. J. Biotechnol.

found to be very useful in these studies (Kijas et al., 2012). Microsatellites Microsatellites are the most frequently used markers to explore genetic diversity and the population structures of domestic animals (Baumung et al., 2004). Relatively large genome abundance and high levels of polymorphism and co-dominance in this kind of marker make it an important tool for genomic analyses (Crispim et al., 2012). Evaluations of eight microsatellite loci polymorphism in five unrelated sheep breeds (Romney, Border Leicester, Suffolk, Awassi, and Australia and New Zealand Merino) showed highly significant differences in allelic frequencies among individuals, indicating that microsatellite markers can be valuable tools in evaluating evolutionary relationships between breeds (Buchanan et al., 1994). Arranz et al. (1998) and Stahlberger-Saitbekova (2001) used microsatellites for genotypic characterization and assessment in Spanish and Swiss sheep breeds, respectively, and these markers were found to be efficient for evaluating genetic diversity and calculating the genetic distances between the animals involved. Almeida (2007) determined the variability of 20 microsatellites in 717 animals of 14 Portuguese sheep breeds, which allowed this author to evaluate the degree of structuring in these Portuguese sheep populations and estimate genetic diversity parameters for each breed. Several studies have used microsatellite markers to investigate local Brazilian breeds. Paiva et al. (2005a) used microsatellite markers for 18 loci to evaluate genetic diversity in both naturalized and exotic sheep (Santa Ines, Bergamacia, Rabo Largo, Morada Nova, and Somalis) and the results were efficient in characterizing the breeds, although they showed low genetic variability. Microsatellites have thus been shown to be excellent marker for the characterization of naturalized breeds (Paiva et al., 2003) and in population studies (Paiva et al., 2005b; El Nahas et al., 2008). Table 2 lists the microsatellite markers data recommended for paternity testing and genetic diversity and variations in sheep by the Food and Agriculture Organization of the United Nations (FAO, 2011). Mitochondrial DNA markers Mitochondria have their own circular DNA (mtDNA) and replication capacities. Mitochondrial inheritance is also known as maternal inheritance as the molecular markers in mitochondrial DNA are only passed through the female (distinct from the biparental inheritance of most nuclear molecular markers) (Olson et al., 2009). The unique genetic and structural characteristics of mitochondrial

markers have been explored by a number of researchers. mtDNA sequencing can be used as a tool for determining evolutionary origins and population dynamics, and is useful in domestication studies because mtDNA has high mutation rates, lacks recombinants, and is maternally inherited – thus allowing the evaluation of divergence between wild and domestic populations over the relatively short time scales of human domestication (Bruford et al., 2003; Toro et al., 2009). mtDNA has been used to investigate the origin of bovines (Loftus et al., 1994), equines (Vila et al., 2001), swine (Giuffra et al., 2000; Larson et al., 2005), goats (Joshi et al., 2004; Sardina et al., 2006), and sheep (Wood and Phua, 1996; Hiendleder et al., 1998; Guo et al., 2005; Pedrosa et al., 2005; Pereira et al., 2006; Tapio et al., 2006; Meadows et al., 2006). Bruford et al. (2003) demonstrated that the majority of mtDNA sheep lineages are derived from a probable site of initial domestication in the “Fertile Crescent” region (which now comprises Israel, West Bank, and some regions of Lebanon, as well as Jordan, Syria, Iraq, Egypt, southeastern Turkey and southwestern Iran). According to Olson et al. (2009), many mitochondrial genes are highly conserved, so these markers can be used to examine very long-term phylogenetic and taxonomic relationships. Indiscriminate crossbreeding between different sheep breeds makes their characterization by nuclear molecular markers more difficult, but mtDNA markers may help solve problems related to the origins of several naturalized breeds throughout the world. A study of genetic diversity undertaken by Meadows et al. (2005) that examined 17 sheep breeds of European and Asian origin found 57 single haplotypes among the 121 animals sequenced. The distributions of the haplotypes indicated that most of the animals were confined to a single breed (51 from 57), while six haplotypes were present in more than one breed. The distributions of these differences showed five distinct peaks, which indicated the presence of divergent haplotype groups. The majority of the haplotypes formed one large group that contained sheep lineage B (of European origin), while the remaining haplotypes formed a separate group (probably corresponding to lineage A of Asian origin). Paiva et al. (2005a) examined six breeds of naturalized sheep in Brazil and observed an overwhelming presence of the European haplogroup, except for two Dorper animals (of African origin), which had mtDNA typical of the Asian haplogroup. These results support the hypothesis that Brazilian sheep originated largely from the European continent. Gonçalves et al. (2010) examined the mitochondrial sequences of the ND5 gene (of subunit 5 of NADH dehydrogenase) in 225 animals of two native breeds (Frontier and Mountain) from southern Brazil (Santa Catarina and Rio Grande do Sul states) and observed significant differences between them. Bayesian phylo-

Crispim et al.

15621

Table 2. Microsatellite markers panel of the International Society for Animal Genetics (ISAG) and FAO by locus, chromosome, primer sequences, annealing temperature, genbank accession number, and allele size in base pairs.

Annealing temperature (°C)

Genebank access number

Allele sizes (bp)

ATTAAAGCATCTTCTCTTTATTTCCTCGC CAGCTGAGCAACTAAGACATACATGCG

55

L01532

96-130

OAR 3

GCTGAACAATGTGATATGTTCAGG GGGACAATACTGTCTTAGATGCTGC

50

U15699

112-130

OarCP38

OAR 10

CAACTTTGGTGCATATTCAAGGTTGC GCAGTCGCAGCAGGCTGAAGAGG

52

U15700

117-129

OarHH47

OAR 18

TTTATTGACAAACTCTCTTCCTAACTCCACC GTAGTTATTTAAAAAAATATCATACCTCTTAAGG

58

L12557

130-152

OarVH72

OAR 25

GGCCTCTCAAGGGGCAAGAGCAGG CTCTAGAGGATCTGGAATGCAAAGCTC

57

L12548

121-145

OarAE129

OAR 5

AATCCAGTGTGTGAAAGACTAATCCAG GTAGATCAAGATATAGAATATTTTTCAACACC

54

L11051

133-159

BM1329

OAR 6

TTGTTTAGGCAAGTCCAAAGTC AACACCGCAGCTTCATCC

50

G18422

160-182

BM8125

OAR 17

CTCTATCTGTGGAAAAGGTGGG GGGGGTTAGACTTCAACATACG

50

G18475

110-130

HUJ616

OAR 13

TTCAAACTACACATTGACAGGG GGACCTTTGGCAATGGAAGG

54

M88250

114-160

DYMS1

OAR 20

AACAACATCAAACAGTAAGAG CATAGTAACAGATCTTCCTACA

59

...

159-211

SRCRSP9

CHI12

AGAGGATCTGGAAATGGAATC GCACTCTTTTCAGCCCTAATG

55

L22201

99-135

OarCB226

OAR 2

CTATATGTTGCCTTTCCCTTCCTGC GTGAGTCCCATAGAGCATAAGCTC

60

L20006

119-153

ILSTS5

OAR 7

GGAAGCAATGAAATCTATAGCC TGTTCTGTGAGTTTGTAAGC

55

L23481

174-218

ILSTS11

OAR 9

GCTTGCTACATGGAAAGTGC CTAAAATGCAGAGCCCTACC

55

L23485

256-294

ILSTS28

OAR 3

TCCAGATTTTGTACCAGACC GTCATGTCATACCTTTGAGC

53

L37211

105-177

SRCRSP5

OAR 18

GGACTCTACCAACTGAGCTACAAG GTTTCTTTGAAATGAAGCTAAAGCAATGC

56

L22197

126-158

MAF214

OAR 16

GGGTGATCTTAGGGAGGTTTTGGAGG AATGCAGGAGATCTGAGGCAGGGACG

58

M88160

174-282

SRCRSP1

CHI13

TGCAAGAAGTTTTTCCAGAGC ACCCTGGTTTCACAAAAGG

54

L22192

116-148

Locus

Chromosome

Primer sequence (5’ > 3’) forward and reverse

OarFCB128

OAR2

OarCP34

15622

Afr. J. Biotechnol.

Table 2. Continued.

MAF33

OAR 9

GATCTTTGTTTCAATCTATTCCAATTTC GATCATCTGAGTGTGAGTATATACAG

60

M77200

121-141

MCM140

OAR 6

GTTCGTACTTCTGGGTACTGGTCTC GTCCATGGATTTGCAGAGTCAG

60

L38979

167-193

OarFCB20

OAR 2

AAATGTGTTTAAGATTCCATACAGTG GGAAAACCCCCATATATACCTATAC

56

L20004

95-120

OarFCB193

OAR 11

TTCATCTCAGACTGGGATTCAGAAAGGC GCTTGGAAATAACCCTCCTGCATCCC

54

L01533

96-136

OarFCB304

OAR 19

CCCTAGGAGCTTTCAATAAAGAATCGG CGCTGCTGTCAACTGGGTCAGGG

56

L01535

150-188

OarJMP29

OAR 24

GTATACACGTGGACACCGCTTTGTAC GAAGTGGCAAGATTCAGAGGGGAAG

56

U30893

96-150

OarJMP58

OAR 26

GAAGTCATTGAGGGGTCGCTAACC CTTCATGTTCACAGGACTTTCTCTG

58

U35058

145-169

MAF65

OAR 15

AAAGGCCAGAGTATGCAATTAGGAG CCACTCCTCCTGAGAATATAACATG

60

M67437

123-127

MAF70

OAR 4

CACGGAGTCACAAAGAGTCAGACC GCAGGACTCTACGGGGCCTTTGC

60

M77199

124-166

MAF209

OAR 17

GATCACAAAAAGTTGGATACAACCGTGG TCATGCACTTAAGTATGTAGGATGCTG

63

...

...

BM1824

OAR 1

GAGCAAGGTGTTTTTCCAATC CATTCTCCAACTGCTTCCTTG

58

...

...

INRA063

OAR 14

ATTTGCACAAGCTAAATCTAACC AAACCACAGAAATGCTTGGAAG

58

...

...

genetic analysis based on ND5 18 haplotypes pointed to the following geographic structures: the frontier haplotype was clustered in a monophyletic clade, while the mountain haplotype showed two paraphyletic clusters. The studies indicated the occurrence of geographic isolation associated with differences in the ways the herds were distributed (which could have caused gene flow reductions)–thus reinforcing the idea that they are two evolutionary lineages. Paiva et al. (2011a) analyzed the Somali sheep breed in northeastern Brazil using molecular and pedigree data, microsatellites, and 404 bp of mtDNA control region and obtained an average of 5.32 alleles of herd diversity, with an expected heterozygosity of 0.5896 and an observed heterozygosity of 0.6451 for the microsatellite loci. Sixteen mtDNA haplotypes were identified, and network analysis made it possible to observe the relationships between all of the haplotypes identified. The mitochondrial genetic variability in this population indicated at least two major haplotypes groups. The maintenance of

several similar haplotypes is not desirable in herd genetic conservation, and it would therefore be better to maintain isolated populations of individuals with distinct haplotypes. When the control regions of mitochondrial DNA (mtDNA) were sequenced to identify phylogenetic relationship between naturalized and commercial Brazilian sheep breeds, the nucleotide diversity value was found to be 0.005 (Silvério et al., 2006). These results indicated that mtDNA AMOVA values were greater than those of nuclear markers. Naturalized Brazilian breeds showed deviations from selective neutrality, as tested by Fu’s Fs (p<0.01), suggesting that these populations are undergoing demographic expansion. Single nucleotide polymorphism (SNP) SNP markers used in association studies, genetic mapping, diagnostic paternity assays, individual identification

Crispim et al.

(traceability), and to detect genetic diseases and/or polymorphisms associated with production traits have long been limited by technological constraints. However, there have been significant advances in the sequencing of mammalian genomes and in the development of bioinformatics tools during the last decade that have improved SNP massal genotyping. Until recently, the standard method of prospecting for SNP markers was based on Sanger's sequencing method, but there are now high-density SNP panels, that have high-coverage genome-wide SNP with markers and there is the probability that these SNP are close to genes of interest and account for some of the population genetic variation. Kijas et al. (2009) developed a panel of 1,536 SNP from 23 domestic and two wild breeds of sheep to analyze the nuclear genome, generating clusters of large groups based on the animals' geographic origins and could excessively identify the population substructures within individual breeds. The high-density genotyping platform available for this specie currently belongs to Illumina (San Diego, CA). The Ovine SNP50 BeadChip was developed in collaboration with the International Genomics Consortium Sheep and contains more than 54,000 SNP, providing uniform genome coverage. This chip was validated in 75 economically important sheep breeds, including Brazilian breeds such as Santa Ines, Morada Nova, and Crioula Lanada. The applications of such high-density chips include association studies of genomic selection, paternity testing, and pedigree mismatching, as well as more accurate analyses of the diversity and compositions of animal breeds (Illumina, 2012). A genome-wide association study (GWAS) of 486 typed animals of the Wild Soay breed (Ovis aries) was undertaken by Jhonston et al. (2011) with the Ovine SNP50 BeadChip and identified (using ~36,000 SNP) by an autosomal gene candidate for horns (RXFP2, Relaxinlike receptor 2). It also appears that there is an additional SNP in the gene which is supported by a new model of horn inheritance in this breed. Thus, the SNP50 BeadChip could be used to determine if the same gene group could explain horn polymorphisms in different breeds or species. Kijas et al. (2012) conducted a study with the goal of assembling a global diversity chip of sheep breeds and typed 2,819 animals from 74 sheep breeds from Asia, Africa, Southwest Asia (Middle East), Caribbean, North America, South America (Santa Ines and Morada Nova), Europe and Australia using the Ovine SNP50 BeadChip (~49,034 SNP). Among the reported results, they were able to show that sheep breeds have maintained high levels of genetic diversity (in contrast to other domestic species such as dogs). These authors also identified specific genomic regions that contained strong evidence of the rapid changes of artificial selection in sheep evolution. In order to understand genetic structure, it is essential

15623

to reach the genetic improvement by genome-wide association studies, genomic selection, and dissection of quantitative characteristics (Kijas et al., 2009). Thus, the information provided by dense SNP chips can aid in our understanding of genetic structure and the recent evolution of domestic species. Paiva et al. (2012) conducted a research project using 17 markers in 467 individuals of six sheep breeds (Crioula n=300 Bergamacia n=24; Corriedale n=28; Pantaneira n=50; Rabo Largo n=20; Santa Ines n=45). Only two SNP markers did not produce consistent results and were excluded. The selected markers were then used in allocation tests using the structure of five repetitions with a total of 250k permutations each, which was efficient in distinguishing between the breeds. The only exceptions were Pantaneira and Crioula, which were grouped together, suggesting that they were closely related and probably should be classified as two ecotypes of the same breed. Thus, even a reduced panel could serve as a useful tool for animal breed-certification and the identification of their sub-products. PERSPECTIVES Analyses of patterns of molecular genetic variation are fundamental to reconstructing the evolutionary history of species and breeds, as well as for evaluating their genetic diversity, population structures, and their taxonomic definitions – which can help us to conserve and reproduce these breeds and minimize loss of genetic variability. Microsatellite and mitochondrial molecular markers are very useful in conservation studies, although SNP markers are rapidly becoming the markers of choice in genetic studies due to their genomic abundance and low costs for large-scale genotyping. The implementation of sequencing projects in domestic species will allow breeders and scientists to objectively evaluate genetic resources, and the genetic variability linked to productive traits and resistance or tolerance to diseases in naturalized breeds represent an obvious target. REFERENCES Almeida PAR (2007). Diversidade genética e diferenciação das raças portuguesas de ovinos com base em marcadores de DNA – microssatélites: uma perspectiva de conservação. Doutorado em Ciência Animal. Universidade Trás-os-Montes e Alto Douro, Vila Real. ARCO (2011). Assistência ao Rebanho de Criadores de Ovinos. Associação Brasileira de Criadores de Ovinos. http://www.arcoovinos.com.br. Accessed 10 de February 2012. Aro DT, Polizer KA, Pena SB (2007). O Agronegócio na Ovinocultura de Corte no Brasil. Rev. Cien. Eletro. Med. Vet. 9(5):1-6. Arranz JJ, Bayón Y, Primitivo FS (1998). Genetic relationships among Spanish sheep using microsatellites. Anim. Genet. 29(6):435-440. Arranz JJ, Bayón Y, San Primitivo F (2001). Genetic variation at microsatellite loci in Spanish sheep. Small Rumin. Res. 39(1):3-10. Baumung R, Simianer H, Hoffmann I (2004). Genetic diversity studies in farm animals – a survey. J. Anim. Breed. Genet. 121:361-373. Bennett S (2004). Solexa Ltd. Pharmacogenomics 5(4):433-438.

15624

Afr. J. Biotechnol.

Bruford MW, Bradley DG, Luikart G (2003). DNA markers reveal the complexity of livestock domestication. Nat. Rev. Genet. 4(11):900910. Buchanan FC, Adams LJ, Littlejohn RP, Maddox JF, Crawford AM (1994). Determination of evolutionary relationships among sheep breeds using microsatellites. Genomics 22:397-403. Cañon J, Checa ML, Carleos C, Vega-Pla JL, Vallejo M, Dunner S (2000). The genetic structure of Spanish celtic horse breeds inferred from microsatellite data. Anim. Genet. 31(1):39-48. Crispim BA, Silva DBS, Banari AC, Seno LO, Grisolia AB (2012). Discriminação Alélica em Ovinos Naturalizados do Pantanal SulMatogrossense por Meio de Marcadores de Microssatélites. J. Selva Andina Res. Soc. 3(1):3-13. El Nahas SM, Hassan AA, Mossallam AAA, Mahfouz ER, Bibars MA, Oraby HAS e Hondt HA (2008). Analysis of genetic variation in different sheep breeds using microsatellites. Afr. J. Biotechnol. 7(8):1060-1068. Elmaci C, Oner Y, Ozis S, Tuncel E (2007). RAPD Analysis of DNA Polymorphism in Turkish Sheep Breeds. Biochem. Genet. 45:691696. FAO (2011). The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by Barbara Rischkowsky & Dafydd Pilling. Rome. Ferreira ME, Grattapaglia D (1996). Introdução ao uso de marcadores moleculares em análise genética. 2ª Ed. Embrapa/Cenargen, Brasilia-DF, Brazil. Giuffra E, Kijas JMH, Amarger V, Carlborg Ö, Jeon JT, Anderson L (2000). The origin of the domestic pig: independent domestication and subsequent introgression. Genetics 154:1785-1791. Gonçalves GL, Moreira GR, Freitas TR, Hepp D, Passos Weimer TADT (2010). Mitochondrial and nuclear DNA analyses reveal population differentiation in Brazilian Creole sheep. Anim. Genet. 41(3):308-310. Grisolia AB, Moreno-Cotulio VR (2012). Molecular Markers and Genetic Diversity in Neotropical Felids, Analysis of Genetic Variation in Animals, Mahmut Caliskan (Ed.), ISBN: 978-953-51-0093-5, InTech, Available from: http://www.intechopen.com/books/analysis-of-geneticvariation-in-animals/molecular-markers-and-genetic-diversity-inneotropical-felids. Grisolia AB, Moreno VR, Campagnari F, Milazzotto M, Adania CH, Garcia JF, Souza EB (2007). Genetic diversity of microsatellite loci in Leopardus pardalis, Leopardus wiedii and Leopardus tigrinus. Genet. Mol. Res. 6(2):382-389. Guo J, Du LX, Ma YH, Guan WJ, Li HB, Zhao QJ, Li X, Rao SQ (2005). A novel maternal lineage revealed in sheep (Ovis aries). Anim. Genet. 36:331-336. Hanotte O, Tawah CL, Bradley DG, Okomo M, Verjee Y, Ochieng J, Rege JE (2000). Geographic distribution and frequency of a taurine Bos taurus and an indicine Bos indicus Y specific allele amongst subSaharan Africa cattle breeds. Mol. Ecol. 9(4):387-396. Hiendleder S, Lewalski H, Wassmuth R, Janke A (1998). The Complete Mitochondrial DNA Sequence of the Domestic Sheep (Ovis aries) and Comparison with the Other Major Ovine Haplotype. J. Mol. Evol. 47(4):441-448. Illumina (2012). Ovine SNP50 Genotyping BeadChip. http://www.illumina.com/documents/%5Cproducts%5Cdatasheets%5 Cdatasheet_ovinesnp50.pdf. Accessed 10 de February 2012. Johnston SE, McEwan JC, Pickering NK, Kijas JW, Beraldi D, Pilkington JG, Pemberton JM, Slate J (2011). Genome-wide association mapping identifies the genetic basis of discrete and quantitative variation in sexual weaponry in a wild sheep population. Mol. Ecol. 20(12):2555-2566. Joshi MB, Rout PK, Mandal AK, Tyler-Smith C, Singh L, Thangaraj K (2004). Phylogeography and origin of Indian domestic goats. Mol. Biol. Evol. 21(1):454-462. Kantanen J, Olsaker I, Adalsteinsson S, Sandberg K, Eythorsdottir E, Pirhonen K, Holm LE (1999). Temporal changes in genetic variation of North European cattle breeds. Anim. Genet. 30(1):6-28. Kijas JW, Lenstra JA, Hayes B, Boitard S, Porto Neto LR, San Cristobal M, Servin B, McCulloch R, Whan V, Gietzen K, Paiva S (2012). Genome-Wide Analysis of the World's Sheep Breeds Reveals High Levels of Historic Mixture and Strong Recent Selection. PLoS. Biol. 10(2):e1001258. doi:10.1371/journal.pbio.1001258.

Kijas JW, Townley D, Dalrymple BP, Heaton MP, Maddox JF, McGrath A, Wilson P, Ingersoll RG, McCulloch R, McWilliam S, Tang D, McEwan J, Cockett N, Oddy VH, Nicholas FW, Raadsma H (2009). A genome wide survey of SNP variation reveals the genetic structure of sheep breeds. PLoS ONE 4(3):4668. Kumar KG, Kumar P, Bhattacharya TK, Bhushan B, Patel AK, Choudhary V, Sharma A (2003). Genetic Relationship Among Four Indian Breeds of Sheep Using RAPD-PCR. J. Appl. Anim. Res. 24(2):177-183. Larson G, Dobney K, Albarella U, Fang M, Matisoo-Smith E, Robins J, Lowden S, Rowley-Conwy P, Andersson L, Cooper A (2005). Worldwide phylogeography of wild boar reveals multiple centers of pig domestication. Science 307(5715):1618-1621. Ligda CH, Altarayrah J, Georgoudis A (2009). Genetic analysis of Greek sheep breeds using microsatellite markers for setting conservation priorities. Small Rumin. Res. 83(1):42-48. Loftus RT, Machugh DE, Bradley DG, Sharp PM, Cunningham EP (1994). Evidence for two independent domestications in cattle. Proc. Natl Acad. Sci. 91:2757-2761. Lopes MS, Lopes MTG, Figueira A, Camargo LEA, Fungaro MHP, Carneiro MS, Vieira MLC (2002). Marcadores moleculares dominantes (RAPD e AFLP). Biotecnol. Cienc. Desenvolv. 29(5):5660. Margulies M, Egholm M, Altman WE (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437(7057):376380. Mariante AS, Albuquerque MSN, Egito AA, McManus C (1999). Advances in the Brazilian animal genetic resources conservation programme. Anim. Genet. Res. Inform. 25(1):107-121. Mariante AS, McManus C, Mendonça JF (2003). Country report on the state of animal genetic resources: Ministério da Agricultura Pecuária e Abastecimento. Brazil. McManus C, Paiva SR, Araújo RO (2010). Genetics and breeding of sheep in Brazil. R. Bras. Zootec. 39:236-246. Meadows JRS, Li K, Kantanen J, Tapio M, Sipos W (2005). Mitochondrial sequence reveals high levels of gene flow between breeds of domestic sheep from Asia and Europe. J. Hered. 96(5):494-501. Meadows JRS, Hanotte O, Drögemüller C, Calvo J, Godfrey R, Coltman D, Maddox JF, Marzanov N, Kantanen J, Kijas JW (2006). Globally dispersed Y chromosomal haplotypes in wild and domestic sheep. Anim. Genet. 37(5):444-453. Meadows JRS, Kijas JW (2009). Re-sequencing regions of the ovine Y chromosome and wild sheep reveals novel paternal haplotypes. Anim. Genet. 40(1):119-123. Melo DC, Oliveira DAA, Seerig A, Carvalho DC (2008). Aplicações práticas de marcadores microssatélites na caracterização genética e identificação de plantéis de tilápia. Rev. Bras. Reprod. Anim. 32(4):220-224. Morais ORO (2001). O melhoramento genético dos ovinos no Brasil. In: Melhoramento genético aplicado à produção animal. Belo Horizonte, FEPMUZ Editora, Brazil. Notter DR (1999). The importance of genetic diversity in livestock populations of the future. J. Anim. Sci. 77:61-69. Oklahoma State University (2007). Animal Science. http://www.ansi.okastate.edu/breeds/sheep Acessed 10 December 2007. Oliveira ACB, Sediyama MAN, Sediyama T, Finger FL, Cruz CD (2002). Variabilidade genética em batata-doce com base em marcadores isoenzimáticos. Hortic. Bras. 20(4):576-582. Olson ZH, Whittaker DG, Rhodes OE (2009). The use of molecular markers in wild sheep Research in North America: a review. Proceeding of the Northern Wild Sheep and Goat Council Biennial Symposium 16:251-269. Paiva SR, Facó O, Faria DA, Lacerda T, Barretto GB, Carneiro PL, Lobo RN, McManus C (2011a) Molecular and pedigree analysis applied to conservation of animal genetic resources: the case of Brazilian Somali hair sheep. Trop. Anim. Health Prod. 43(7):14491457. Paiva SR, Mariante Ada S, Blackburn HD (2011b). Combining US and Brazilian microsatellite data for a meta-analysis of sheep (Ovis aries) breed diversity: facilitating the FAO Global Plan of Action for

Crispim et al.

Conserving Animal Genetic Resources. J. Hered. 102(6):697-704. Paiva SR, Silvério VC, Egito AA, MacManus C, Faria DA, Mariante AS, Castro SR, Albuquerque MSM, Dergam J (2003). Caracterização Genética da Raça Santa Inês. In: 2ND International Symposium on Sheep and Goat Production, João Pessoa, Anais do Segundo Sincorte 1:487-499. Paiva SR, Silvério VC, Egito AA, McManus CM, Faria DA, Mariante AS, Castro STR, Albuquerque MSM, Dergam JA (2005b). Genetic variability of the Brazilian hair sheep breeds. Pesq. Agrop. Bras. 40(9):887-893. Paiva SR, Silvério VC, Paiva DAF, Mcmanus CM, Egito AA, Faria DA, Mariante AS, Castro STR, Albuquerque MSM, Dergam JA (2005a). Origin Of The Main Locally Adapted Sheep Breeds Of Brazil: A RFLP-PCR Molecular Analysis. Arch. Zootec. 54:395-399. Paiva SR, Vieira FD, Yamagishi MEB, Lacerda T, Vasconcelos C, Mcmanus C, Tanno P, Higa R, Carneiro PLS, Azevedo HC, Faco O, Souza CJH, Araujo AM, Martins VM, Caetano AR (2012). Validation of a low density SNP panel for breed certification testing in Brazilian sheep (Ovis aries) breeds as a tool for flock genetic management. In: International Plant and Animal genome Conference, San Diego. Pariset L, Joost S, Gargani M, Valentini A (2012). Landscape Genomics in Livestock. In: Analysis of Genetic Variation in Animals. INTECH, Rijeka, Croatia. Pedrosa S, Uzun M, Arranz JJ, Gutiérrez-Gil B, Primitivo FS, Bayón Y (2005). Evidence of three maternal lineages in near eastern sheep supporting multiple domestication events. Proc. R. Soc. B. 272(1):2211-2217. Pereira F, Davis SJM, Pereira L, Mcevoy B, Bradley DG, Amorim A (2006). Genetic signatures of a Mediterranean influence in Iberian Peninsula sheep husbandry. Mol. Biol. Evol. 23:1420-1426. Pérez-Pardal L, Royo LJ, Beja-Pereira A, Curik I, Traoré A, Fernández I, Casais R, Goyache F (2009). Y-specific microsatellites reveal an African subfamily in taurine (Bos taurus) cattle. Anim. Genet, doi: 10.1111/j.1365-2052.2009.01982.x. Pidancier N, Jordan S, Luikart G, Taberlet P (2006). Evolutionary history of the genus Capra (Mammalia, Artiodactyla): discordance between mitochondrial DNA and Y-chromosome phylogenies. Mol. Phylogenet. Evol. 40:739-749. Qasim M, Ahmad H, Ghafoor S, Afridi SG, Muhammad I, Imtia AK (2011). Estimation of Genetic Diversity in Sheep (Ovis aries) using Randomly Amplified Polymorphic DNA. Int. J. Anim. Vet. Adv. 3(1):69. Ramey II RR, Luikart G, Singer FJ (2000). Genetic Bottlenecks Resulting from Restoration Efforts: The Case of Bighorn Sheep in Badlands National Park. Rest. Ecol. 8(4):85-90.

15625

Rosa AJM, Paiva SR (2009). Marcadores moleculares e suas aplicações em estudos populacionais de espécies de interesse zootécnico. Planaltina, DF: Embrapa Cerrados, Brazil. Sardina MT, Ballester M, Marmi J, Finocchiaro R, Van Kaam JBCHM, Portolano B, Folch JM (2006). Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage. Anim. Genet. 37(4):376-378. Sechi T, Miari S, Piras D, Crasta L, Mulas G, Carta A (2009). Genetic variation of goat Y chromosome in the Sardian population. Ital. J. Anim. Sci. 8(2):159-161. Silvério VC, Paiva SR, Faria DA, McManus CM, Dergam JA, Oliveira AA, Lôbo RNB, Sousa WH, Mariante AS, Egito AA (2006). Phylogenetic study on the main Brazilian naturalized sheep breeds. th In: 8 World Congress on Genetics Appl. Livestock Production, Proceedings of 8th World Congress on Genetics Appl. Livestock Production. Belo Horizonte: Instituto Prociência. Brazil. Souza CA, Paiva SR, McManus CM, Azevedo HC, Mariante AS, Grattapaglia D (2012). Genetic diversity and assessment of 23 microsatellite markers for parentage testing of Santa Inês hair sheep in Brazil. Genet. Mol. Res. 11(2):1217-1229. Stahlberger-Saitbekova N, Schläpfer J, Dolf G, Gaillard C (2001). Genetic relationships in Swiss sheep breeds based on microsatellite analysis. J. Anim. Breed. Genet. 118(6):379-387. Tapio M, Marzanov N, Ozerov M, Inkulov M, Gonzarenko G, Kiselyova T, Murawski M, Viinalass H, Kantanen J (2006). Sheep mitochondrial DNA variation in European, Caucasian, and Central Asian areas. Mol. Biol. Evol. 23(9):1776-1783. Toro MA, Fernández J, Caballero A (2009). Molecular characterization of breeds and its use in conservation. Livest. Sci. 120(3):174-195. Valouev A, Ichikawa J, Tonthat T (2008). A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequencedictated positioning. Gen. Res. 18(7):1051-1063. Vila C, Leonard JA, Götherström A, Marklund S, Sandberg K, Liden K, Wayne R, Ellegren H (2001). Widespread origins of domestic horse lineages. Science 291(5503):474-477. Wood NJ, Phua SH (1996). Variation in the control region sequence of the sheep mitochondrial genome. Anim. Genet. 27(1):25-33. Xiao F, Yong F, Ting S, Jin-Fu W (2009). Six Local Sheep Breeds AFLP Analysis of Genetic Diversity in Xinjiang. China Animal Husbandry & Veterinary Medicine. China.