BAB M DAFTAR PUSTAKA Adhi, I. P. G. W. 1993. Pengapuran tanah masam untuk kedelai. p. 171-188. Dalam Somaatmadja, M. Ismunadji, Sumamo, M. Syam, S. 0.Manurung, Yuswadi (penyunting). Kedelai. Badan Penelitian dan Pengembangan Pertanian, Pusat Penelitian dan Pengembangan Tanaman Pangan, Bogor. Amien. I., L. Hakim dan M. Sudjadi. 1980. Aluminium pada beberapa tanah Ultisol Banten. Pengaruh aluminium tanah pada pertumbuhan kedelai dan jagung. Pusat Penelitian Tanah Bogor. Aniol, A. 1990. Genetics of tolerance to aluminium in wheat (Triticrrm aestivum L. Thell). Plant and Soil 124:223-227. Anwar, S. 1999. Pengklonan gen-gen yang diinduksi oleh aluminium pada kedelai [(Glycine m a (L.) Merrill]. Disertasi. Program Pascasarjana Institut Pertanian Bogor. 86p. Atkinsin, M. M., S. L. Midland. J. J. Sims and N. T. Keen. 1996. Syringolide 1 triggers c a 2 + influx, Kt efflux and extracellular alkalization in soybean cells carrying the disease-resistance gene Rpg 4'. Plant Physiol. 112: 297-302. Azizah. 1996. Toleransi beberapa galur kedelai [(Glycine m m (L.) Merrill] terhadap tanah masam Podsolik Merah Kuning Jasinga. Skripsi. Fakultas Pertanian PB. Baharsjah, J. S., D. Suardi, I. Las. 1993. Hubungan iklim dengan pertumbuhan kedelai. p. 87-89. Dalam Somaatmadja, M. Ismunadji, Sumamo, M. Syam, S. 0. Manurung, Yuswadi (penyunting). Kedelai. Badan Penelitian dan Pengembangan Pertanian, Pusat Penelitian dan Pengembangan Tanaman Pangan, Bogor. Basu, U., D. Godbold, G. J. Taylor. 1994. Aluminium resistance in Triticum aestivum associated with enhanced exudation of malate. Plant Physiol. 144: 747-753. Bennet, R. J. 1995. The use of hematoxylin in screening perennial ryegrass (Loliurn perenne) for aluminium tolerance. South African J. Plant and Soil 12 (2): 6572
. 1997. The response of lucerne and red clover roots to aluminium/hematoxylin: how universal is the hematoxylin test for aluminium? South African Journal of Plant and Soil 14 (3): 120-126 Bhojwani, S. S. and M. K. Razdan. 1983. Plant tissue culture, theory and practice. Elsevier Science Publishers, Amsterdam-Oxford-New York-Tokyo. 502p. Cooper, R. L. 1997. Breeding soybeans for diverse production environments in the temperate zone. p. 3-7. In Napompeth, B. (ed.). Soybean, feeds the world. Proceedings of World Soybean Research Conference V, Ching Mai, Thailand. 2 1-27 February 1994. Deihaize, E., S. Craig, C. D. Beaton, R J. Bennet, V. C. Jagadish, P. 1. Randall. 1993. Aluminium tolerance in wheat (Tritictim aestivum L.) 1. Uptake and distribution of aluminium in root apices. Plant Physiol. 103: 685-693. and P. R. Ryan. 1995. Aluminium toxicity and tolerance in plants. Plant Physiol. 107: 3 15-321. and P. J. Randall. 1993. Aluminum tolerance in wheat (Trificumaestivum L.). Plant Physiol. 103:695-702. Fauconnier. 1986. Soya, fertilizer for yield and quality. Institute, Switzerland. 60p.
International Potash
Foy, C. D., T. E. Jr. Carter, J. A. Duke and T. E. Devine. 1993. Correlation of shoot and root growth and its role in selecting for aluminium tolerance in soybean. J. Plant Nutr. 16:305-325. George. E. F. and P. D. Sherrington. 1983. Plant propagation by tissue culture. Handbook and Directory of Commercial Laboratories Exegetics Limited. Gunawan, L. W. 1992. Teknik kultur jaringan tumbuhan. Departemen Pendidikah dan Kebudayaan, Direktorat Jenderal Pendidikan Tinggi. Pusat Antar Universitas Bioteknologi, Institut Pertanian Bogor. 165p. Harjadi, S. S. dan S. Yahya. 1988. Fisiologi stres lingkungan. PAU Bioteknologi, Institut Pertanian Bogor. 236p. Huang, J. W., D. L. Grunes and L. V. Kochian. 1992. Aluminium effects on the kinetics of calcium uptake into cells of the wheat root apex. Planta 188: 414421.
Ishikawa, S. and T. Wagatsuma. 1998. Plasma membrane permeability of root-tip cells following temporary exposure to A1 ions is a rapid measure of Al tolerance among plant species. Plant Cell Physiol. 39(5): 5 16-525. Ismail, I. G. dan S. Effendi. 1993. Pertanaman kedelai, p. 189-217. Dalam Somaatmadja, M. Ismunadji, Sumarno, M. Syam, S. 0.Manurung, Yuswadi (penyunting). Kedelai. Badan Penelitian dan Pengembangan Pertanian, Pusat Penelitian dan Pengembangan Tanaman Pangan. Bogor. Ismunadji, M. dan S. N. Mahmud. 1993. Peranan unsur mikro untuk meningkatkan produksi kedelai. p. 189-2 17. Dalam Somaat madja, M . Ismunadji, Sumarno, M. Syam, S. 0.Manurung, Yuswadi (penyunting). Kedelai. Badan Penelitian dan Pengembangan Pertanian, Pusat Penelitian dan Pengembangan Tanaman Pangan, Bogor. Jones, D. L., L. V. K~chian. 1995. Aluminium inhibition of the inositol 1, 4, 5triphosphate signal transduction pathway in wheat roots: a role in aluminium toxicity? Plant Cell 7: 1913-1922. Jusuf, M. 1999. Penelitian dasar genetika dan bioteknologi untuk pengembangan agribisnis. p. 161-1 73. Prosiding ekspose, hasil penelitian bioteknologi pertanian. Badan Penelitian dan Pengembangan Pertanian, Departemen Pertanian. Jakarta, 3 1 Agustus- 1 September 1999. Kasai, M., M. Sasaki and S. Tanakamaru. 1993. Possible involvement of abscisic acid in increases in activities of two vacuolar H+-pumps in barley roots under aluminium stress. Plant Cell. Physiol. 34(8):1335-1338. Kasim. N 2000. Eksudasi dan akumulasi asam organik pada beberapa kedelai (Glycine maw (L.) Merr.) genotipe toleran aluminium. Tesis. Program Pascasarjana, Institut Pertanian Bogor. 4Sp.
, D. Sopandie, M. Jusuf dan S. Harran. 1999. sebagai salah satu mekanisme toleransi tanaman aluminium. p. 309-3 14. Prosiding ekspose, hasil pertanian. Badan Penelitian dan Pengembangan Pertanian. Jakarta, 3 1 Agustus- 1 September 1999.
Eksudasi asam organik kedelai yang dicekam penelitian bioteknologi Pertanian, Departemen
Kauss. 1987. Some aspects of calcium-dependent regulation in plant metabolism. Plant Physiol. 38: 47-72. Khasawneh, F. E., E. C. Sample, E. J. Kamprath. 1980. The role of phosphorus in agriculture. Amer. Soc. Agron., Madison-Wisconsin USA.
Lazof, D. B., J. G. Goldsmith, T. W. Rufty, R. W. Linton. 1994. Rapid uptake of aluminium into cells of intact soybean root tips. Plant Physiol. 106:1107-1 114. Ma, J. F. 2000. Role of organic acids in detoxification of aluminum in higher plants. Plant Cell Physiol. 41 (4): 383-390
., S. J. Zheng and H. Matsumoto. 1997. Specific secretion of citric acid induced by A1 stress in Cassia iora L. Plant Cell Phy siol. 38(9): 1019-1025. ka, I. 1999. Peningkatan keragaman genetik melalui seleksi in viho dan keragaman somaklonal untuk ketahanan terhadap faktor biotik dan abiotik. Pusat Penelitian dan Pengembangan Tanaman Pangan-Balai Penelitian Bioteknologi Tanaman Pangan Bogor. P.27. Marschner, H. 1995. Mineral nutrition of higher plants. Academic Press, Harcourt Brace and Company, Publishers. 889p. Matsumoto, H. 1991. Biochemical mechanism of the toxicity of aluminium and the sequestration of aluminium in plant cells. Plant-Soil Interaction at Low pH: 825-838. ., Y. Yarnamoto and M. Kasai. 1992. Changes of some properties of the plasma membrane enriched, fraction of barley roots related to aluminum stress: Membrane associated ATP ase, aluminum and calcium. Soil Sci. Plant Nutr. 38 (3):411-419.
Ownby, J. D. 1993. Mechanism of reaction of hematoxylin with aluminium-treated wheat roots. Physiol. Plant 87: 371-380 Pardal, S. J., D. R. Untari, A. Sisharmini, D. Rijadi dan M. Herman, 1999. Regenerasi kedelai secara in vitro. p. 27-38. Prosiding seminar, Perhimpunan Bioteknologi Pertanian Indonesia. Surabaya, 12-14 Maret 1997. Pierik, R. L. M. 1987. Publishers. 340p.
In Vitro culture of higher plants.
Martinus Nijhoff
Raper, C. D. and P. J. Kramer. 1987. Stress physiology. In J R. Wilcox (ed.). Soybeans: Improvement, production and uses. American Society Of Agronomy Inc. 16:588-63 1. Rath, I. 1996. Selection of plants for resistance against phytotoxins, agricultural chemicals and antimetabolites using in viho techniques. p. 1-10. Prosiding Litbang Kedelai, Departemen Pertanian.
Richards, K. D., E. J. Schott, Y. K. Sharma, K. R. Davis and R. C . Gardner. 1998. Aluminium induces oxidative stress genes in Arabzdopsis fhaliana. Plant Physiol. 116:409-418. Runtunuwu, S . D. 2000. Penanda molekuler ketahanan tanaman kelapa terhadap penyakit gugur buah Phytophthora. Disertasi. Program Pasca Sarjana IPB. 69p. Salisbury, F. B. and C. W. Ross. 1995. Fisiologi tumbuhan (jilid 2). Terjemahan oleh D. R. Lukman, dan Sumaryono. Penerbit ITB Bandung. 173p. Sopandie, D. 1996. Fisiologi dan genetik daya adaptasi kedelai terhadap cekaman kekeringan dan pH rendah dengan Al tinggi. Laporan Akhir Riset Unggulan Terpadu. Dewan Riset Nasional. ~rinives,P., P. Kareeros and R. Kaveeta. 1997. Inheritance of embryoid formation ability in soybean. p. 83-85. In Napompeth, B. (4.) Soybean . feeds the world. Proceedings, World Soybean Research Conference V Chiang Mai, Thailand, 21-27 February 1994. Sudarsono. 1996. Marker random amplified polymorphic (RAPD). Lab. Biol~gi Molekuler Tanaman, Jurusan Budidaya Pertanian, Fakultas Pertanian, Institut Pertanian Bogor. Sumarno. 1998. Prospek pengembangan kedelai di Indonesia. p. 1-4. Soybean breeding seminar, December 9, 1998. Pusat Penelitian dan Pengembangan Tanaman Pangan, Bogor. . 2000. Pilihan strategi program untuk peningkatan produksi kedelai. Lokakarya pengembangan kedelai, Direktorat Bina Produksi Tanaman Pangan, Jakarta. 7 p.
Suniharti, Yunastri dan S. Kumiasih (kompilasi). 1999. Deskripsi varietas unggul padi dan palawija 1993-1998. p. 22-28. Pusat Penelitian dan Pengembangan Tanaman Pangan- Badan Penelitian dan Pengembangan Pertanian, Bogor. Taiz, L. and E. Zeiger. 1991. Plant physiology. Publishing Company Inc. S59p.
The Benjaminlcummings
Taylor, G. J. 1991. Current views of the aluminium stress response. The physiological basis of tolerance. Current Topics in Plant Biochem. and Physiol. 10157-93.
., A. Basu, U. Basu, J. J. Slaski, G. Zhang and A. Good. 1997. Alinduced, 51-kilodalton, membrane-bound proteins are associated with resistance to Al in a segregating population of wheat. Plant Physiol. 114:363372.
Van Sint Jan, V., C. C. de Macedo, J. M. Kinet and J. Bouharmont. 1997. Selection of Al-resistant plants from a sensitive rice cultivar, using somaclonal variation, in vitro and hydroponic cultures. Euphytica 97: 303-3 10. Wattimena, G. A., L. V. Gunawan, N. A. Mattjik, E. Syamsudin, N. M. A. Wiendi, A. Ernawati (penelaah A. S. Abidin). 1992. Bioteknologi tanaman. Depertemen Pendidikan dan Kebudayaan-Direktorat Jenderal Pendidikan Tinggi, PAU Bioteknologi Institut Pertanian Bogor. 309p. Yutono. 1993. Inokulasi rhizobium pada kedelai. p. 217-230. Dalam Somaatmadja, M. Ismunadji, Sumarno, M. Syam, S. 0.Manurung, Yuswadi (penyunting). Kedelai. Badan Penelitian dan Pengembangan Pertanian. Pusat Penelitian d m Pengembangan Tanaman Pangan, Bogor.
137 Tabel Lampiran 1. Komposisi Media Murashige-Skoog yang telah Dimodifikasi Stok
Bahan
A
=No3
Konsentrasi Larutan (gll) 82.500
Pemakaian ml stoM media 20
B
KNO3
95.000
20
1900.000
C
KaP0.i H3B03 KI NalMo04.2HzO CoCii.6HzO
34.000 1.240 0.166 0.050 0.005
5
170.000 6.200 0.830 0.250 0.025
D
CaCIl.H20
88.000
5
440.000
E
MgS04.7HzO MnSO4.4HlO ZnS04.7HzO C~S04.5Hz0
74.000 4.460 1.720 0.005
5
370.000 22.300 8.600 0.025
F
NaGDTA.2HlO FeS04.7HlO
3.730 2.780
10
37.300 27.800
Myo
Myo-Inositol
10.000
10
100.000
Vit
Thiamine Niacin Pyridoxine Glycin Gula
0.010 0.050 0.050 0.200 30.000
10
0.100 0.500 0.500 2.000
Tabel Lampiran 2. Suhu Rata-rata Bulanan di Rumah Kaca Bulan-Tahun Desember-1999 Jan& 2000 Feb~ari Marct April
Mei Juni Juli Agustus
suhu CC) Pagi 22.87 22.55 22.79 22.45 22.57 22.26 22.33 22.32 22.79
Siang 31.21 30.58 30.55 32.48 31.77 31.77 31.40 32.20 30.63
Sore 30.62 29.03 30.38 28.87 31.30 30.32 30.43 31.65 25.87
mgll 1650.000
Tabel Lampiran 3.
HasiI Analisis Contoh Tanah Podsolik Gajruk dan Kapur yang Dipakai dalam Percobaan
Jenis Analisis
Hasil Penetapan) *
Tanah 1. pHHzO (1:I) KC1 (1 : 1) 2. C-org (%) N-total (Oh) 3. P-Bray (ppm) 4. P- HCI 25 % (ppm) 5. Ca (md100g) Mg (me/ 1OOg) K (me/lOOg) Na (me/100g) KTK (me/ 100g) 6. KB (Yo) 7. Al(me/lOOg) H (me/ 100g) 8. 0.05 N HCI (ppm)
Fe Cu Zn MII 9. Tekstur ( O/O) Pasir Debu Liat lo. KA (%)
4.80 3.60 2.51 0.20 I .O 78.50 2.90 1.53 0.41 0.35 39.90 13.00 23.32 1.62 2.56 0.28 2.76 5.76 9.21 23.21 67.58 14.42
Kapur 1.
Ca ('?A)
2. Mg(%) 3. DN (Oh)
29.06 0.88 87.44
*)Analisis dilakukan di Laboratorium Ilmu Tanah Fak.Pertanian IPB
Tabel Larnpiran 4. Hasil Analisis Tanah Percobaan Pendahuluan dengan Perlakuan Kapur
Unit Percob.
Ca
... 1-a 1-b 1-C 2-a 2-b 2-c 3-a 3-b 3-C 4-a 4-b 4-c 5-a 5-b 5-c
19.14 19.87 21.48 17.51 16.48 15.04 10.34 13.38 19.60 9.72 12.82 11.02 0.12 8.97 9.16
N KC1
NNH40Ac pH 7.0 Mf3
K
me/100 g 2.21 1.75 4.64 4.50 4.94 8.09 7.28 7.26 12.38 9.04 9.62 9.32 5.01 6.22 7.08
0.33 0.38 0.36 0.39 0.36 0.29 0.31 0.26 0.26 0.28 0.28 0.31 0.28 0.30 0.26
*)dihitung dari:
Na
Al
H
Kej.Al (%)*
0.52 0.43 0.57 0.57 0.48 0.39 0.52 0.48 0.52 0.52 0.57 0.40 0.48 0.52 0.57
..me/100 g . . 0.26 0.53 0.96 1.60 0.98 1.42 6.22 4.45 3.73 8.98 11.73 9.33 30.22 31.74 29.31
0.18 0.98 0.53 0.82 0.76 0.88 0.81 0.71 0.72 0.90 0.64 0.75 0.96 0.93 1.06
1.16 2.31 3.42 6.51 4.22 5.63 25.21 17.23 10.22 31.46 33.49 30.71 83.69 66.47 63.19
...
A1 x 100% Ca+Mg+K+Na+Al
Tabel Lampiran 5. Hiisil Analisis Media, Galur Yellow Biloxy dan Lumut pada Perlakuan A1 secara Kultur In Vitro Aluminium
Hasil Analisis Yellow Biloxy
(PP~) 1
2a
2b
3
6.62 4.15 A,=O(pH 5.8) 5.2 6.62 897 2.14
[email protected]) 4.8 8.97
[email protected]) 4.6 11.33 8.75 1.74 A4=400 (pH 4.5) 5.3 15.43 15.43 1.74 As=600 (pH 4.5) 5.6 27.06 1.40 Ket: -kecuali 2a, semua pemberian A1 sekaligus 1 = pH akhir media -2a= Kadar protein total (%) -2b= Kadar protein total (YO) -3 = Bobot basah tanaman (&anaman) -4 = Jumlah daun (helai/tanaman)
-
Lumut
4
1
4 5 10 11 11
5.7 4.8 5.5 5.1 5.4
2b
2n
8.47 11.28 17.25 21.83 21.90
8.47 11.28 10.57 11.77
-
3
4
3.72 2.48 2.29 2.03 0.48
9.0 6.5 5.0 7.0 9.0
Tabel Lampiran 6. Pengaruh Pemberian Aluminium Secara Bertahap terhadap pH Media Akhir, Rata-rata Panjang Akar, Bobot Basah Akar, Bobot Kering Akar dan Asam Organik Eksudat Galur G~=YellowBiloxi
I pH Media I I
Panjang Akar cm4.2739.00 7Gf 1.08
I
1 Bobot Basah 1 1
M-
Akm
3.43f0.46
1
Bobot Kering
I
Akar(
1
Asam Organilc-Eksudat 1 2 2-wnolrrmol0.236239.1923 0.0628 0.129
Ket; l=asam sitrat;Z=asam malat Tabel Lampiran 7.Pengaruh Pemberian Aluminium Secara Bertahap terhadap Jumlah Tunas dan Bobot Baseh Tunas Tanaman Kedelai Hasil Penapisan Kultur In Viho Galur
Jumlah Tunas
G~=YellowBiloxi G~=Slamet Gs=Sindoro G.+=Wilis G~=Arksoy Gs=Lumut
3.0f2.5 3.0f2.5 3.0f2.5 3.09.5 4.0f1.5 7.0f1.5
Bobot Basah Tunas (&tanaman) 4.34rt0.44 4.37M.41 3.33f1.45 3.31f1.47 4.73f0.05 4.92f0.13
Tabel Lampiran 8. Kadar Protein Total Kedelai Akibat Penambahan Berbagai Konsentrasi Al Secara Bertahap dengan Kuitur I n Vitro Galur G1=Yellow Biloxy Gz=Slamet G3=Sindoro G4=Wilis Gs=Arksoy Gs=Lumut
Protein Total (mgk sampel) 48.93 48.92 46.80 45.60 40.70 38.50
I
Tabel Lampiran 9. Rata-rata Tinggi Tanaman, Jumlah mas dan Umur Panen Berbagai Galur Kedelai Benih Asal Penapisan Lapang dan Asal Kultur In Vitro Generasi AwaI (Ro)dan Generasi Pertama (R1) di Rumah Kaca dengan Pemberian A1 Secara Bertahap Perlakuan
Tinmi tanaman (cm) Benih* Ro** R 1***
G~=Yellow Biloxy
81.6 108.3
Jumlah mas Benih Ro RI 8 12 12
112.3
JJmur vanen Char11 Benih Ro RI 86
84
86
Gz=Slamet 7 11 11 87 83 87 82.4 100.4 110.4 G3=Sindoro 80.7 94.8 96.8 14 14 86 86 86 8 G4=Wilis 85 83 85 85.3 106.2 108.2 7 14 14 Gs=Arksoy 7 87 88 88 39.2 91.4 93.4 11 I1 Gc=Lumut 30.0 81.4 83.4 7 12 12 81 81 Ket: *)tidak lewat kultur in vitro;* *)lewat kultur in vitro; * * *)berasal dari &
1
1
1
TabeI Lampiran 10. Produksi Biji Kering Kedelai & Rumah Kaca pada Indeks Kejenuhan Aluminium 100 dengan Pemberian A1 secara Bertahap pada Kultur In Vitro
Ket: Angka yang diikuti oleh huruf kecil yang sama pada baris yang sama tidak berbeda nyata menurut uji t pada tarafuji 5%. Tabel Lampiran 11. Nilai F hitung Sidik Ragam Peningkatan pH Media, Jumlah Tunas Maksimum dari Berbagai Galur Kedelai Generasi Awal (Ro) Hasil Penapisan Kultur In Yitro setelah ~enambahan Aluminium ke dalam Media Kultur SK
DB
Peningkatan pH Media
EuG EuA G/K Galat Total
5 2 10 18 35
608.40' 23.58' 0.32~
-
Jumlah Tunas Maksinnun
0.61" 1.6gU 0.08'"
-
Protein total
F-Tabel .05
0.013~ 1.120~'
2.77 3.55 2.41
Tabel Lampiran 12. Nilai F hitung Sidik Ragam Berbagai Peubah Galur Kedelai & Hasil Penapisan Kultur In Vifro setelah Penambahan Aluminium ke dalam Media Kultur DB 8 45 53
SK Perlakuan/Galur Galat Total
1 3.51-
-
2
3
4
0.65"
0.46"
0.75"
-
-
Ket: 1. Pertambahan pH media 2. Pertambahan tinggi tanaman 3. Pertambahan bobot basah tanaman 4. Bobot kering tanaman Tabel Lampiran 13. Komposisi Larutan Pewarna Enzim Peroksidase, Asam Fosfatase dan Malate Dehidrogenase Larutan enzim pewarna
1. Peroksidase -50 mM natrium asetat (pH 5.0) SO ml -CaC12 50 mg -3-Amino-9-etilkarbasol 25 mg -N,N-Dimethylformamide 2 ml 2, Asam Fosfrrtase -SO mM Na-asetat buffer pH 5.0 -Na-a napthyl acid phosphatase 50 rng -MgC12 50 mg (1 ml) -Fast Garnet GBG salt 50 mg (1 ml) 3. Malate Dehydrogenase - 50 mM Tris-HC1, pH 8 5 50 ml - NAD (Nicotinamide Dinucleotide) 10 mg (1 ml) Malic acid 150 mg (1 ml) NBT (Nitro Blue Tetrazo1ium)or MTT (Tetrazolium Thiazolyl Blue) 10 mg (1 ml) -Phenazine Methosulfate (PMS) 2 mg (0 4 ml)
-
143 Tabel Lampiran 14. Komposisi Separating Gel yang digunakan
.Akuades .TrisliC1 1.5 M, pH 8.8 .SDS 1W/o Acrilamidehis (A)-vacum 15 menit Ammonium persulfat 10% TEMED (N,N,N',N' tetra methylethylene diamine / C~HIGNZ Tabel Lampiran 1 5 . Konsentrasi Larutan Protein dan Kadar Protein Akar Berbagai Galur Kedelai &) Galur
[Protein] (CLB/LLI)
Kadar protein ( m d g sampel) Lar.stok
Y.Biloxy Slamet Sindoro Wilis Arksoy Lumut
0.427 0.575 0.468 0.420 0.599
0.476
Tabel Lampiran 16.
Galur
[Protein] (P~PI)
Y.Biloxy 3.79 4.78 Slatnet Sindoro . 4.54 4.64 Wilis 3.13 Arksoy 3.78 Lumut
0.850 1.130 0.920 0.820 1.190 0.950
(PI
18.7 13.9 17.0 19.0 13.4 16.8
untuk sumur (perlu 8 wg) akuades (PI) 1.3 6.1 3.0 1.O 66 3-2
sampel buffer 2xkuat (pl) 20 20 20 20 20 20
Konsentrasi Larutan Protein dan Kadar Protein Daun Berbagai Galur Kedelai (&) Hasil Penapisan Kultur In Viho setelah Penambahan Aluminium ke dalam Media Kadar protein (mgk sampel) 7.49 9.38 8.99 9.28 6.23 7.52
Untuk sumur (perlu 10 ~ l g ) Lar.stok (pl)
akuades (pl)
sampel buffer 2xkuat (pl)
2.64 2.10 2.20 2.20 3.20 2.60
17.36 17.90 17.80 17.80 16.80 17.40
20 20 20 20 20 20
144 Tabel Lampiran 17. Jenis Primer yang Digunakan Primer I . Acak: OPB-08 OPB- 11 OPZ- 11 OPA-07 OPC-09 OPD-03 OPB-04 OPB-17 OPA-I 0 OPZ-07 OPZ-03
Susunan basa 5' GTCCACACGG 3' 5' GTAGACCCGT 3' 5' CTCAGTCGCA 3' 5' CTACGCTCAC 3' 5' CTCACCGTCC 3' 5' GTCGCCGTCA 3' 5'GGACTGGAGT 3' S'AGGGAACGAG 3' 5' GTGATCGCAG 3' 5' CCAGGAGGAC 3' 5' CAGCACCGCA 3'
2.Spesifik Plf Plr
5' ATGGCAGCTACTCAGGAAGATTGT 3' 5' AACGGATGAAGTTTCGGGCG3'
Tabel Lampiran 18.
Komposisi Pereaksi dan Bufer yang Dipakai untuk Analisis DNA Tanaman Kedelai Hasil Penapisan Kultur In Viho
Larutan Penyangga a. Bufer Ekstrak
b. Larutan Pencuci c. Larutan TE
d. Larutan TAE 50x
e. Loading buffer
Komposisi 10 ml CTAB 10% 2 ml EDTA 0.5 M, pH 8.0 12.6 ml NaCI 5 M 20.4 ml akuabides 70 ml etanol70% 1 ml Tris-HC1 I M, pH 8.0 1 ml EDTA 0.5 M, pH 8.0 (dilarutkan dengan akuades hingga voI. 100 ml) 24.2 g Tris base 5.71 ml asam asetat glasial 10.0 ml EDTA 0 . 5 M, pH 8.0 (dilarutkan dengan akuades hingga vo1.100 ml) 2.5 % Bromophenol blue 40 % sukrosa
Tabel Lampiran 19. Nilai F hitung Sidik Ragam Tinggi Tanaman, Jumlah Ruas, Umur Berbunga, Umur Panen, Jurnlah Polong Berisi Dua Biji dari Berbagai Galur Kedelai Generasi Awal (&) Hasil Penapisan Kultur In Vifro setelah Penambahan Aluminium ke dalam Media di Rurnah Kaca SK Perlakuan Eu K G/K Galat
29 5 4 20 30
Total
59
Eu G
Get.
1
DB
7.98* 14.73* 15.49 * 4.79*
-
2 4.55* 9.52* 11.98* 1.82"
-
3 264.63* 1210.76* 346.80* 26.10'
4 10.80* 29.13* 32.94* 1.79-
5 24.34, 11.98* 137.02' 4.89*
6 60.28* 144.51* 193.44* 12.58*
-
l=Tinggi tanaman 2=Jumlah ruas 3=Umur berbunga
4=Umur panen 5=Jumlah polong berisi dua biji 6=Produksi biji kering
Tabel Lampiran 20. Nilai F hitung Sidik Ragam Tinggi Tanaman, Jumlah Ruas, Jumlah Polong Berisi Dua Biji dan Produksi Biji Kering dari Berbagai Galur Kedelai Generasi Awal (Ro) tanpa Melalui Penapisan In Vitro pada Percobaan Rumah Kaca
SK Eu G
Ket:
DB
Eu K G/K Galat
5 4 20 30
Total
59
1
2
1942.67' 1189.45* 40.57*
1.392.211.25"
l=Tinggi tanaman 2=Jumlah ruas 3= Jumlah polong berisi dua biji 4=Produksi biji kering
3
129.11* 239.75* 30.99*
4 92.75* 134.41* 7.45*
Tabel Lampiran 21. Hasil Analisis Kadar A1 Akar Kedelai yang Berasal dari Penanaman Benih (kontrol) Perlakuan (tanpa pemberian Al) G1=Yellow Biloxy G~=Slamet G~=Sindoro G4=Wilis G5=Arksoy Gs=Lumut
Ulangan I
------ mg/g------
0.230 0.380 0.176 0.249 0.170 0.120
Total
Ratarata
0.436 0.692 0.302 0.450 0.330 0.224
0.218 0.346 0.151 0.225 0.165 0.112
I1
0.206 0.312 0.126 0.201 0.160 0.104
Tabel Lampiran 22. Hasil Analisis Kadar Al Daun Kedelai yang Berasal dari Penanaman Benih (kontrol) Perlakuan (tanpa pemberian Al) G~=YellowBiloxy Gz=Slarnet G3=Sindoro G.+=Wilis Gs=Arksoy Gs=Lurnut
ulangan I
---, "g/g---
0.027 0.014 0.078 0.014 0.075 0.068
Total
Rata-rata
0.052 0.034 0.096 0.029 0 101 0.106
0.026 0.017 0.048 0.015 0.051 0.053
I1
0.025 0.020 0.018 0.015 0.026 0.038
Tabel Larnpiran 23. Hasil Analisis Kadar A1 Akar dari Berbagai Galur Kedelai Generasi Kedua (Rz) di Rumah Kaca Hasil Penapisan Kultur In Vitro setelah Penambahan Aluminium ke dalarn Media Galur
Total
ulangan
I
Rata-rata
I1 ---,,,g/g---
G,=Yellow Biloxy + 500 ppm Al Gz=Slarnet + 500 ppm Al G~=Sindoro+ 500 pprn A1 G4=Wilis + 500 pprn Al Gs=Arksoy + 400 pprn A1 , Gs=Lumut + 300 ppm A1
0.800 0.540 0.390 0.340 0.290 0.180
0.500 0480 0.314 0.284 0.206 0.162
1.300 1.020 0.704 0.624 0.496 0.342
0.650 0510 0.352 0.312 0.248 0.171
Tabel Lampiran 24. Hasil Analisis Kadar A1 Daun dari Berbagai Galur Kedelai Generasi Kedua (Rz) di Rumah Kaca Hasil Penapisan Kultur In Vitro setelah Penambahan Aluminium ke dalam Media Kultur Rata-rata
Total
ulangan I
Perlakuan
I1
---mg/g---
G,=Yellow Biloxy + 500 ppm Al Gz=Slarnet + 500 ppm A1 G3=Sindoro + 500 ppm A1 G4=Wilis + 500 ppm Al Gs=Arksoy + 400 ppm A1 Gs=Lurnut + 300 ppm A1 Tabel Lampiran 25.
SK Galur Galat Total
DB 5 6 11
Ket: 1. 2. 3. 4.
5. 6. 7.
8.
0.114 0.120 0.290 0.102 0.119 0.104
0.244 0.260 0.600 0.202 0.259 0.224
0.122 0.130 0.300 0.101 0.129 0.112
Nilai F hitung Sidik Ragam Berbagai Galur Kedelai Generasi Kedua (Rz) Hasil Penapisan Kuitur In Vitro pada Percobaan Rumah Kaca 5 3 4 74.034' 36.49* 36.64'
2 1 5.69' 32.76'
-
0.130 0.140 0.310 0.100 0.140 0.120
-
-
-
1 Peningkatan A1 akar Peningkatan A1 daun Protein total Asam organik Total Asam sitrat Asam malat Bobot basah tanaman di rumah kaca Bobot kering tanaman di rumah kaca
-
6 143.99'
7 4.94'
8 2.69'" I
Tabel Lampiran 26. Nilai F hitung Sidik Ragam Tinggi Tanaman, Jumlah Ruas, Umur Berbunga, Umur Panen, Jumlah Polong Berisi Dua Biji dari Berbagai Galur Kedelai Generasi Kedua (Rz)Hasil Penapisan Kultur In Vitro setelah Penambahan Aluminium ke dalam Media di Rumah Kaca SK Perlakuan Eu G Eu K Galur pada KO KI
G 4 G5
1
Kz K3 I(4
1.Kej. pa& GI Gz
G3 Ga GK Galat Total
Ket:
DB 29 5 4 1 1 1 1 1 1 1 1 1 1 20 30 59
l=Tinggi tanaman 2=Jumlah mas 3=Umur berbunga
1 21.09* 55.27. 74.95.
2 13.93* 24.42* 63.97.
1.77tn
1.31"
3
214.82* 648.33* 476.17* 2.29'" 11.57* 0.14" 17.29* 28.00* 25.00. 576.00. 576.00* 256.00* 576.00* 121.OO* 54.17*
-
4
5
25.73. 13.36* 88.65* 13.90* 60.47* 64.04* 3.860.430.244.31. 2.685.19* 3.8618.08* 54.24* 31.86f 75.00* 21.35* 60.75. 16.69* 31.159~ 46.65* 22.69* 23.90* 9.19* 86.64* 27.00* 68.95* 3.063.09*
4=Umur panen 5=Jumlah polong berisi dua biji 6=Produksi biji kering
6 61.04* 76.39* 222.1l * 1.75'" 1.460.76140.63* 268.56* 3(1.32* 158.75. 7.00' 77.12* 396.31f 461.17* 24.99*